Back to Journals » Infection and Drug Resistance » Volume 17

Replicon-Based Typing About IncG Plasmids and Molecular Characterization of Five IncG Plasmids Carrying Carbapenem Resistance Gene blaKPC-2

Authors Guo H, Luo J, Chen S, Yu T, Mu X, Chen F, Lu X, He J, Zheng Y, Bao C, Wang P ORCID logo, Yin Z, Li B

Received 24 January 2024

Accepted for publication 29 May 2024

Published 12 July 2024 Volume 2024:17 Pages 2987—2999

DOI https://doi.org/10.2147/IDR.S461039

Checked for plagiarism Yes

Review by Single anonymous peer review

Peer reviewer comments 2

Editor who approved publication: Dr Sandip Patil



Huiqian Guo,1,2,* Jing Luo,1,3,* Suming Chen,1 Ting Yu,4 Xiaofei Mu,4 Fangzhou Chen,4 Xiuhui Lu,4 Jiaqi He,4 Yali Zheng,4 Chunmei Bao,2 Peng Wang,4 Zhe Yin,4 Boan Li1– 3

1Department of Clinical Laboratory, the Fifth Medical Center of PLA General Hospital, Beijing, 100039, People’s Republic of China; 2School of Medical Laboratory, Weifang Medical University, Weifang, 261053, People’s Republic of China; 3Medical School of Chinese PLA, Beijing, 100853, People’s Republic of China; 4State Key Laboratory of Pathogen and Biosecurity, Academy of Military Medical Sciences, Beijing, 100071, People’s Republic of China

*These authors contributed equally to this work

Correspondence: Boan Li, Department of Clinical Laboratory, the Fifth Medical Center of PLA General Hospital, Beijing, 100039, People’s Republic of China, Email [email protected] Zhe Yin, State Key Laboratory of Pathogen and Biosecurity, Academy of Military Medical Sciences, Beijing, 100071, People’s Republic of China, Email [email protected]

Purpose: To investigate the genetic diversity of IncG plasmids, we have proposed a typing scheme based on replicon repA and performed comparative genomic analysis of five IncG plasmids from China.
Methods: p30860-KPC, p116965-KPC, pA1705-KPC, pA1706-KPC and pNY5520-KPC total in five IncG plasmids from clinical isolates of Pseudomonas and Enterobacteriaceae, respectively, were fully sequenced and were compared with the previously collected reference plasmid p10265-KPC.
Results: Based on phylogeny, IncG-type plasmids are divided into IncG-I to IncG-VIII, the five plasmids belong to IncG-VIII. A detailed sequence comparison was then presented that the IncG plasmid involved accessory region I (Tn 5563a/b/c/d/e), accessory region II (ISpa19), and accessory region III (blaKPC-2-region). Expect for the pNY5520-KPC, the rest of the plasmids had the same backbone structure as the reference one. Within the plasmids, insertion sequences Tn 5563d and Tn 5563e were identified, a novel unknown insertion region was found in Tn 5563b/c/d/e. In addition, Tn 6376b and Tn 6376c were newly designated in the study.
Conclusion: The data presented here including a typing scheme and detailed genetic comparison which provide an insight into the diversification and evolution history of IncG plasmids.

Keywords: IncG plasmids, blaKPC-2, phylogenetic tree, multidrug resistance, mobile elements

Introduction

Infections with multidrug-resistant organisms are causing a global health crisis.1,2 Acquired antimicrobial resistance genes in organisms are commonly captured and horizontally transferred by mobile genetic elements, such as plasmids. The IncG plasmid has become one of the major multidrug-resistant plasmids.

IncG plasmid was first isolated from clinical bacteria in Germany, in 1975.3 Since then, IncG plasmids have been reported in the Americas, Europe and Asia, carried by Pseudomonas and Enterobacteriaceae in clinical and environment settings. Botts described four multidrug resistance plasmids on bacteria from the sediments of an urban coastal wetland in America, one of which was IncP-6 (IncG).4 Pérez proposed that the plasmid types IncL, IncHI2, IncFIB, IncN, IncC, and IncP-6 (IncG) carrying carbapenem resistance genes might be responsible for the dissemination of carbapenemase genes in K. oxytoca isolates in Spain.5 Other reports of plasmids from the literature are shown in Table 1. The scheme of replicon homology to identify Inc groups is widely recognized, and our previous study also proposed a novel group and three separately clustering subgroups of IncpSTY plasmids in Pseudomonas, which are formally genotyped via replicons.6–8 However, to date, no research on the typing of IncG plasmids exists.9

Table 1 IncG Plasmids Reported in the Literature

In order to explore the drug resistance mechanism of bacteria, our laboratory has been collecting multi-drug resistant strains since 2016. So far, our laboratory has collected a total of five strains from Pseudomonas and Enterobacteriaceae that carry IncG plasmid harboring blaKPC-2. In this work, the first typing of the IncG plasmid replicon repA was performed. A collection of six fully sequenced blaKPC-2-carrying IncG plasmids from different clinical strains were considered, including the reference p10265-KPC (as shown in our previous study and the first identified IncG-type plasmid in China);10 Characteristics of the backbone region, accessory modules, and insertion sites were dissected by comprehensive genomic comparison of these six plasmids. Diversification and parallel evolution of IncG plasmids are revealed, and monitoring of bacterial resistance transmission by IncG plasmids is recommended.

Materials and Methods

Bacterial Strains and Identification

Except for the reference plasmid, the remaining five plasmids p30860-KPC, p116965-KPC, pA1705-KPC, pA1706-KPC, and pNY5520-KPC were all sequenced in this study and collected from hospitalized patients in four Chinese public hospitals (Table 2). All bacterial strains were subjected to species identification using 16S rDNA gene sequencing followed by genome sequence-based average nucleotide identity analysis (ANI) (http://www.ezbiocloud.net/tools/ani).11

Table 2 Background Information of Strains Carrying IncG Plasmids Sequenced in This Study

Sequencing and Sequence Assembly

Bacterial strains 172116965, NY5520 and A1706 were subjected to draft-genome sequencing using a paired-end library with an average insert size of 400 bp (range: 150–600 bp) on a HiSeq sequencer (Illumina, CA, USA). In addition, bacterial strains 172116965, NY5520 and A1705 were subjected to complete-genome sequencing with a sheared DNA library with an average size of 15 kb (range: 10–20 kb) on a PacBio RSII sequencer (Pacific Biosciences, CA, USA). Bacterial strain 30860 was sequenced from mate-pair libraries with average insert size of 5 kb (range: 2–10 kb) using a MiSeq sequencer (Illumina, CA, USA). Sequence assembly were performed as previously described.12–14

Sequencing and Sequence Assembly

Open reading frames (ORFs) and pseudogenes were predicted using RAST 2.0 combined with BLASTP/BLASTN searches against the UniProtKB/Swiss-Prot database and the RefSeq database.15–17 Annotation of resistance genes, mobile elements, and other features was carried out using online databases, including CARD,18 ResFinder,19 ISFinder,20 INTEGRALL,21 DANMEL,22 and the Tn Number Registry. Multiple and pairwise sequence comparisons were performed using Clustal Omega (https://www.ebi.ac.uk/Tools/msa/clustalo/) and BLASTN, respectively. Gene organization diagrams were drawn using Inkscape 1.0 (https://inkscape.org/en/).

Phylogenetic Analysis

Using repAp10265-KPC as reference sequence, and using Coverage≥85% and Identity≥90% as screening conditions, 107 plasmids were obtained by blast in NCBI (the search deadline is August 18, 2022). All the plasmids in this study and one plasmid with the same Coverage and Identity values were randomly selected to be included in the phylogenetic analysis, with a total of 29 plasmids. The repAIncG sequences of plasmids were aligned using Clustal Omega and then maximum-likelihood phylogenetic trees were constructed from core sequences using MEGA 11 with a bootstrap iteration of 1000, and displayed using iTOL (https://itol.embl.de).23

Electroporation Transfer

Plasmid p116965-KPC as a representative IncG plasmid of arbitrary choice was transformed from its wild-type isolate into E. coli DH5α in Enterobacteriaceae, through electroporation experiments. To prepare competent cells for electroporation, 200 mL of overnight culture of E. coli DH5α in super optimal broth (SOB) at an optical density (OD600) of 0.4 to 0.6 was washed three times with electroporation buffer (0.5 M mannitol and 10% glycerol) and concentrated into a final volume of 2 mL. One microgram of DNA was mixed with 100 μL of competent cells for electroporation at 25 μF, 200 Ω, and 2.5 Kv. The resulting cells were suspended in 500 μL of SOB, and an appropriate aliquot was spotted on brain heart infusion (BHI) agar plates containing 4 μg/mL meropenem to select for E. coli containing blaKPC-2 plasmid. By PCR, transfected E. coli was further identified using blaKPC-2 and repAp116965-KPC sequences (Table 3).

Table 3 Primers of Genes

Antimicrobial Susceptibility Testing

Bacterial antimicrobial susceptibility was tested using BioMérieux VITEK 2 and interpreted as per the 2022 Clinical and Laboratory Standards Institute (CLSI) guidelines.24

Nucleotide Sequence Accession Numbers

The p30860-KPC, p116965-KPC, pA1705-KPC, pA1706-KPC and pNY5520-KPC sequences were submitted to GenBank under accession numbers MN477223, MN539620, MH909348, MH909350 and CP096939, respectively.

Results

Overview of Sequenced IncG Plasmids

Strains 30860, 172116965, and NY5520 came from Enterobacter cloacae, Citrobacter sp. and Pseudomonas aeruginosa, respectively, and strains A1706 and A1705 came from Klebsiella pneumoniae (Table 2). Screening for the resistance genes of the above strains was consistent with antimicrobial susceptibility testing (Figure 1, Tables 4 and S1), and indicated that the plasmids involved carried only the blaKPC−2 gene. A phylogenetic tree (Figure 2A) constructed from the repAIncG core sequences of 29 arbitrarily selected representative plasmids (Table S2; last accessed August 18th 2022) clustered into eight major clades, which we designate as types IncG-I to IncG-VIII. Most branches in this tree had bootstrap values ≥70%, suggesting that this maximum-likelihood phylogenetic tree robustly reflected the evolutionary relatedness of IncG plasmids. For genomic classification and phylogeny of IncG plasmids, the pairwise average nucleotide identity (ANI) values of the 29 sequenced plasmid repA sequences were calculated (Figure 2B and Table S3). A total of eight IncG types were identified, corresponding to the types in the phylogenetic tree, and thus both ANI-based plasmid typing and phylogenomic analysis yielded consistent results. These results confirm parallel diversification and evolution of IncG plasmids IncG-I to IncG-VIII. The phylogenetic tree suggests that plasmids p30860-KPC, pA1706-KPC, p116965-KPC, pA1705-KPC and pNY5520-KPC belong to type IncG-VIII. The evolutionary distances between p30860-KPC, pA1706-KPC, p116965-KPC and pA1705-KPC were relatively close, while the evolutionary distance between pNY5520-KPC and the other four plasmids was relatively large.

Table 4 Antimicrobial Drug Susceptibility Profile

Figure 1 A heatmap of prevalence of resistance genes.

Notes: The original data are shown in Table S1.

Figure 2 repAIncG typing.

Notes: (A) A maximum-likelihood phylogenetic tree of repAIncG sequences. The tree is constructed from core sequences. Bootstrap confidence values are shown next to each branch. The green colored dot represents plasmids from this study, and the green colored triangle represents the reference plasmid. (B) A heatmap of the pairwise average nucleotide identity (ANI) values of repAIncG sequences. The original data are shown in Table S3.

The five plasmids sequenced had complete and circular sequences and varied in size from approximately 33–42 kb (Figure 3). A pairwise sequence comparison using BLASTN showed that plasmids p30860-KPC, pA1706-KPC, p116965-KPC, pA1705-KPC and the reference plasmid p10265-KPC10 had >99.90% nucleotide identity across ≥96% of their complete sequences, while plasmid pNY5520-KPC and the other four plasmids showed ≥97.97% nucleotide identity across 56% to 69% of their complete sequences (Figure 4 and Table S4). The modular structure of each plasmid was divided into the backbone and the accessory modules that was represented by acquired DNA regions associated with mobile elements (Figures 5 and 6). A detailed sequence comparison applied to the collection of the five plasmids generated the following conclusions. i) Compared with p30860-KPC, pA1706-KPC, p116965-KPC and pA1705-KPC, pNY5520-KPC lacked some backbone genes downstream of accessory region III. ii) Compared with p30860-KPC, pA1706-KPC, p116965-KPC, and pA1705-KPC, pNY5520-KPC had only accessory regions II and III. iii) The composition of accessory region I of p30860-KPC (pA1706-KPC had the same sequence in the accessory region I), p116965-KPC and pA1705-KPC differed. iv) The composition of accessory region III of p116965-KPC and pNY5520-KPC differed from that of the other four plasmids.

Figure 3 Schematic maps of the plasmids.

Notes: Genes are denoted by arrows and colored based on gene function classification. The innermost two circles indicate the GC-Skew [(G-C)/(G + (C)] and the GC content.

Figure 4 A heatmap of pairwise sequence comparison of the plasmids.

Notes: The original data are shown in Table S4.

Figure 5 Linear comparison of plasmid genome sequences.

Notes: Genes are denoted by arrows and colored based on gene function classification. Shading regions denote shared regions of homology (>90% nucleotide identity).

Figure 6 Accessory regions.

Notes: (A) Tn5563a/b/c/d/e and ISpa19. (B) blaKPC-2-region. Genes are denoted by arrows and colored based on gene function classification. Shading regions denote shared regions of homology (>95% nucleotide identity).

Backbone Genes of Sequenced IncG Plasmids

The group of five plasmids in our study carry three partition genes parA/B/C and a downstream replicase gene repA with strong similarity (>97% identity and >96% identity, respectively) to that of reference plasmids p10265-KPC and Rms149 (the archetypical IncG-type plasmid). The repA gene encodes replication proteins, and the parA gene encodes an ATPase, whereas parB and parC encode auxiliary partition proteins, which constitute an IncG-type consecutive par-rep gene cluster. Therefore, these plasmids belong to the IncG incompatibility group. All five plasmids also contain the MOBP family mobilization module,25–27 which is composed of five genes, mobA (relaxase/primase fusion protein), mobB (oriT recognition-like protein), mobC (relaxosome protein), and mobD and mobE (auxiliary proteins), and lack the conjugal transfer gene regions, consistent with p10265-KPC and Rms149. Additionally, the five plasmids and the reference plasmid share backbone genes kfrA, ofxX, brnT, and brnN. However, plasmids p10265-KPC, p30860-KPC, pA1706-KPC, p116965-KPC and pA1705-KPC had the backbone gene cluster msrB-msrA-yfcG-corA-orf573, while this backbone gene cluster was missing in plasmids pNY5520-KPC and Rms149 (Figures 3 and 5).

Accessory Modules of Sequenced IncG Plasmids

Accessory modules of the five sequenced IncG plasmids in this study were classified as Accessory regions I, II, and III. Plasmid pNY5520-KPC had only accessory regions II and III, but the other four plasmids had accessory regions I, II, and III. Accessory region II was insertion sequence ISpa19, which was inserted between the backbone genes kfrA and ofxX, corresponding to that of p10265-KPC. Accessory region I was mainly composed of Tn5563d or its variant Tn5563e. The transposon Tn5563e in p116965-KPC differed from the transposon Tn5563d in p30860-KPC, pA1706-KPC and pA1705-KPC, mainly by the insertion of IS4321R. However, an approximately 290 bp sequence was inserted into the merT gene of Tn5563b/d/e; the insertion sequence in Tn5563b differed by 7 bp from Tn5563d/e. Accessory region I of pA1705-KPC, which consisted of Tn5563d, repAIncG, tnpRTn5563d, and Δorf240 (deletion of 102 bp compared with orf240), differed from that of the other plasmids (Figure 6A).

Accessory region III of plasmids p30860-KPC, pA1706-KPC and pA1705-KPC are inserted upstream of the backbone gene msrB, identical to reference plasmid p10265-KPC. Genomic comparison of p116965-KPC, pNY5520-KPC, and reference p10265-KPC for accessory region III revealed the following differences. i) Accessory region III of reference p10265-KPC is the Tn6296 variant (the major gene environment of blaKPC in China.28–30). The tnpATn6376 in plasmid p116965-KPC had an insertion of Tn6583 (ISApu2-orf372-ISApu1); the novel variant Tn6376 was designated as Tn6376c. ii) Compared with p116965-KPC, the Tn6376c-3’ in plasmid p10265-KPC had an insertion of ΔblaTEM-1; the variant structure was designated as Tn6376b. iii) Different from other plasmids, the structure of accessory region III in plasmid pNY5520-KPC was ΔrepB-orf396-orf279-klcA-5’-Tn5403-klcA-3’-korC-ΔISKpn6-blaKPC-2-Tn6376tnpAISKpn26-ΔTn4662a; ΔtnpAISKpn26 was truncated at both ends, therefore, we hypothesize that ISKpn26 originally existed in pNY5520-KPC and the two ends of ISKpn26 were truncated due to the insertion of ΔTn6296 and ΔTn4662a, and that Tn5403 was inserted into the klcA gene after the insertion of ΔTn6296, causing a truncation of the klcA gene (Figure 6B).

Transferability and Bacterial Antimicrobial Susceptibility

The IncG plasmid p116965-KPC, representative of those used in this study, could be transferred from its wild-type isolate into DH5α through electroporation, generating E. coli transformants 172116965-KPC-2-DH5α. Sequences in blaKPC-2 and repAp116965-KPC were used for verification and 172116965-KPC-2-DH5α was further confirmed by PCR detection and amplicon sequencing (Figure S1). As expected, all five bacterial strains and 172116965-KPC-2-DH5α were resistant to all the β-lactam. However, 172116965-KPC-2-DH5α remains susceptible to all other drugs tested (Table 4). In summary, transformant 172116965-KPC-2-DH5α harbored a non-conjugative plasmid p116965-KPC, which carries the blaKPC-2 gene to mediate the resistance to β-lactams.

Discussion

Numerous IncG plasmids have now been reported. Despite this, a systematic summary of IncG plasmids has not previously been published. In 1975, the archetype IncG plasmid Rms149 was first found in clinical Pseudomonas aeruginosa strain Ps142 in Germany.3 The nucleotide sequence analysis of Rms149 was published in 2005.31 In 2007, IncG plasmid pRSB105, containing a novel macrolide resistance gene isolated from the environment, was reported in Germany.32 Subsequently, in 2011 and 2013, IncG plasmids pRIO-533 and pCOL-134 were reported in Brazil and Colombia, respectively. From 2016 to 2022, IncG plasmids were reported four times in China, three times in Japan,5,10,35–40 and once each in the United States, Spain, the Czech Republic and Argentina.4,41,42 Given that all the strains harboring IncG plasmids were of clinical significance, so that it is possible that the real extent of the distribution of IncG plasmids is unknown.

To explore the genetic evolutionary relationship of IncG plasmids, we propose an ML typing scheme based on repA sequences that divides IncG type plasmids into eight subtypes: IncG-I to IncG-VIII. The archetypal IncG plasmid Rms149 belongs to the type IncG-V, the backbone and accessory elements of which are quite different from those of the plasmids in our study (Figure 5). We speculated that due to their distant evolutionary relationship, the plasmids in our study would exhibit large difference in their backbone structure and different characteristics in their accessible mobile elements. Although the plasmids in this study all belonged to IncG-VIII, according to the phylogenetic relationship of repAIncG, the evolutionary distances among p30860-KPC, pA1706-KPC, p116965-KPC and pA1705-KPC were relatively close, while the evolutionary distance between pNY5520-KPC and the previous four plasmids was relatively distant. This result is consistent with the diversity of gene structure among these plasmids and further reveals the genetic evolution of IncG plasmids. Additionally, p30860-KPC was captured from E. cloacae, pA1706-KPC and pA1705-KPC were captured from K. pneumoniae, p116965-KPC was captured from Citrobacter sp, pNY5520-KPC was captured from P. aeruginosa, collected from samples taken at hospitals in Guangdong Province, Liaoning Province, Hunan Province, and Henan Province, respectively. At the same time, the IncG subtypes reported in the literature to date include IncG-V, IncG-VI and IncG-VIII, which have been found in continents such as Europe, Asia, North America, and South America. According to the literature, it is known that IncG-V plasmids are distributed in Europe, North America and South America, while IncG-VI plasmids are only reported in Europe. Compared to its distribution in Europe and South America, IncG-VIII plasmids are more widely distributed in Asia. The plasmids in this study came from different species and different regions yet have extremely high coverage and similarity (Figure 4), indicating that IncG plasmids similar to the reference p10265-KPC have strong horizontal transmission ability.

The accessory module of the IncG plasmid is relatively simple. Accessory modules of IncG plasmids in this study, mainly Tn5563d/e, ISpa19 and Tn6296 variants, showed high consistency. Among them, Tn5563d has a insertion of IS4321R, and the resulting sequence is named Tn5563e. Prototype Tn5563a was initially identified in plasmid pRA2 (accession number: U88088.2, an endogenous 33-kb plasmid from Pseudomonas alcaligenes NCIB 9867 (strain P25X).43 Compared to the prototype Tn5563a, Tn5563b has a 286 bp insertion sequence, causing truncation of the merT gene,10 whereas Tn5563c is inserted with IS5057 compared with Tn5563d.44 Remarkably, at the position of the 286 bp insertion sequence of Tn5563b, Tn5563c/d/e have a 293 bp insertion sequence, and 284 bp in the two sequences are identical. Therefore, we speculate that these two sequences belonged to the same unknown insertion region. The insertion region has an ORF size of 210 bp bounded by 20 bp inverted repeats (IRL: GGTCGCTTCAGAATTCGGAA; IRR: TTCCGTTTTCTGAGGTGACC) and further flanked by a 9 bp direct repeat (DR: CCATCATGG) at both ends. The 293 bp insertion sequence of Tn5563d was assigned as prototype of the unknown insertion region. Although the 293 bp insertion sequence of Tn5563c/e coincides with the structure of the unknown insert element, IS5075 and IS4321R are inserted between the ORF and DR of Tn5563c and Tn5563e, respectively. The difference between the 286 bp insertion sequence of Tn5563b and the unknown insertion region is the loss of a 7 bp DR. Additionally, compared with Tn5563c/d/e, ΔmerT-3’ in Tn5563b has lost 45 bp. Therefore, in terms of evolutionary relationship, it is possible that the unknown insertion region inserted into Tn5563a resulted in Tn5563d, followed by Tn5563b/c/e due to insertion, transposition and other events (Figure 6A).

The blaKPC-2-region of IncG plasmids in this study all belonged to the Tn6296 variant. This region of p30860-KPC, pA1705-KPC, and pA1706-KPC were consistent with reference p10265-KPC (coverage: 100%, identity: 100%), which is composed of ΔTn6296 and Tn6376b. However, the blaKPC-2-region of p116965-KPC differed from reference p10265-KPC only in that Tn6376b was replaced by Tn6376c. Compared with the prototype Tn6376, Tn6376c had a difference of 104 bp in IRR_Tn6376 and IRR_ISKpn27, and an insertion of Tn6583; compared with Tn6376b, Tn6376c had difference of 252 bp, and a deletion of ΔblaTEM-1. This suggests that Tn6376c experienced different insertion and transposition between IRR_Tn6376 and IRR_ISKpn27. In contrast, the blaKPC-2-region of pNY5520-KPC had an insertion of Tn5403 in truncated Tn6296, and due to insertion of ΔTn4662a, had ΔISEc33 replaced by ΔISKpn26, as well as a deletion of DRs_Tn6376 (Figure 6B).

Conclusion

In Conclusion, most IncG plasmids carrying the blaKPC−2 gene may be caused by artificial selection. However, the IncG plasmids are widely spreading in a variety of bacteria species by intercellular transfer, belonging to broad-spectrum plasmids. As the IncG plasmids have apparently become the repository for the blaKPC−2 gene, monitoring of bacterial resistance transmission via the IncG plasmids should be strengthened. In this work, we provided the first typing scheme against IncG plasmids. Based on the replicon sequences (IncG-I to IncG-VIII), IncG plasmids could be classified into eight subtypes. To further present the genetic structure of the IncG plasmids, we performed a detailed genomic comparison of five IncG plasmids carrying carbapenem resistance gene blaKPC-2 from clinical Pseudomonas and Enterobacteriaceae species. The insertion regions Tn5563d, Tn5563e and a novel unknown insertion region were identified, and novel insertion regions Tn6376b and Tn6376c named. We speculated that evolution may occur between Tn5563 and its variants due to translocation, insertion, or deletion. This study not only reveals the gene structure of the IncG plasmid carrying blaKPC−2, but also provides deeper genetic insight into characteristics of the IncG plasmids.

Data Sharing Statement

The datasets generated for this study can be found in the complete nucleotide sequences of plasmids p30860-KPC, p116965-KPC, pA1705-KPC, pA1706-KPC and pNY5520-KPC were submitted to GenBank under accession numbers MN477223, MN539620, MH909348, MH909350 and CP096939 respectively.

Ethics Statement

This study used the clinical bacterial isolates obtained from the Chinese public hospitals as listed in Table 2. Since the bacterial isolation was part of the routine hospital laboratory procedures. According to relevant legislation/policy of China (http://www.nhc.gov.cn/fzs/s3576/201808/14ee8ab2388440c4a44ecce0f24e064c.shtml), this study was not subject to ethical review. The research involving biohazards and all related procedures were approved by the Biosafety Committee of the Beijing Institute of Microbiology and Epidemiology.

Acknowledgments

All experiments and data analyses were done in Dr. Dongsheng Zhou’s laboratory.

Author Contributions

All authors made a significant contribution to the work reported, whether that is in the conception, study design, execution, acquisition of data, analysis and interpretation, or in all these areas; took part in drafting, revising or critically reviewing the article; gave final approval of the version to be published; have agreed on the journal to which the article has been submitted; and agree to be accountable for all aspects of the work.

Funding

This work was supported by the National Key R & D Program of China (2022YFC2303900) and the Foundation of State Key Laboratory of Pathogen and Biosecurity (SKLPBS2116) of China.

Disclosure

The authors report no conflicts of interest in this work.

References

1. Trubiano JA, Worth LJ, Thursky KA, Slavin MA. The prevention and management of infections due to multidrug resistant organisms in haematology patients. Br. J. Clin. Pharmacol. 2015;79(2):195–207. doi:10.1111/bcp.12310

2. Raine R. Control of multidrug-resistant organisms. Afr J Thorac Crit Care Med. 2019;25(1):3. doi:10.7196/SARJ.2019.v25i1.009

3. Hitoshi Sagai VK, Hasuda K, Shizuko Iyobe H. R Factor-Mediated Hitoshi Resistance in Pseudomonas to Aminoglycoside aeruginosa. Jap J Microbiol;1975;19(6):427–432.

4. Botts RT, Apffel BA, Walters CJ, et al. Characterization of four multidrug resistance plasmids captured from the sediments of an urban coastal wetland. Front Microbiol. 2017;8:1922. doi:10.3389/fmicb.2017.01922

5. Pérez-Vazquez M, Oteo-Iglesias J, Sola-Campoy PJ, et al. Characterization of carbapenemase-producing Klebsiella oxytoca in Spain, 2016-2017. Antimicrob Agents Chemother. 2019;63(6). doi:10.1128/AAC.02529-18

6. Carloni E, Andreoni F, Omiccioli E, Villa L, Magnani M, Carattoli A. Comparative analysis of the standard PCR-based replicon typing (PBRT) with the commercial PBRT-KIT. Plasmid. 2017;90:10–14. doi:10.1016/j.plasmid.2017.01.005

7. Partridge SR, Kwong SM, Firth N, Jensen SO. Mobile genetic elements associated with antimicrobial resistance. Clin Microbiol Rev. 2018;31(4). doi:10.1128/CMR.00088-17

8. Chen F, Wang P, Yin Z, et al. VIM-encoding Inc(pSTY) plasmids and chromosome-borne integrative and mobilizable elements (IMEs) and integrative and conjugative elements (ICEs) in Pseudomonas. Ann Clin Microbiol Antimicrob. 2022;21(1):10. doi:10.1186/s12941-022-00502-w

9. Orlek A, Stoesser N, Anjum MF, et al. Plasmid classification in an era of whole-genome sequencing: application in studies of antibiotic resistance epidemiology. Front Microbiol. 2017;8:182. doi:10.3389/fmicb.2017.00182

10. Dai X, Zhou D, Xiong W, et al. The IncP-6 Plasmid p10265-KPC from pseudomonas aeruginosa carries a novel ΔISEc33-Associated bla KPC-2 gene cluster. Front Microbiol. 2016;7:310. doi:10.3389/fmicb.2016.00310

11. Richter M, Rosselló-Móra R. Shifting the genomic gold standard for the prokaryotic species definition. Proc Natl Acad Sci U S A. 2009;106(45):19126–19131. doi:10.1073/pnas.0906412106

12. Fang H, Feng J, Xu Y, et al. Sequencing of pT5282-CTXM, p13190-KPC and p30860-NR, and comparative genomics analysis of IncX8 plasmids. Int J Antimicrob Agents. 2018;52(2):210–217. doi:10.1016/j.ijantimicag.2018.04.012

13. Fu J, Zhang J, Yang L, et al. Precision methylome and in vivo methylation kinetics characterization of Klebsiella pneumoniae. Genomics Proteomics Bioinf. 2022;20(2):418–434. doi:10.1016/j.gpb.2021.04.002

14. Li C, Jiang X, Yang T, et al. Genomic epidemiology of carbapenemase-producing Klebsiella pneumoniae in China. Genomics Proteomics Bioinf. 2022;20(6):1154–1167. doi:10.1016/j.gpb.2022.02.005

15. Brettin T, Davis JJ, Disz T, et al. RASTtk: a modular and extensible implementation of the RAST algorithm for building custom annotation pipelines and annotating batches of genomes. Sci Rep. 2015;5:8365. doi:10.1038/srep08365

16. Boratyn GM, Camacho C, Cooper PS, et al. BLAST: a more efficient report with usability improvements. Nucleic Acids Res. 2013;41:W29–33. doi:10.1093/nar/gkt282

17. O’Leary NA, Wright MW, Brister JR, et al. Reference sequence (RefSeq) database at NCBI: current status, taxonomic expansion, and functional annotation. Nucleic Acids Res. 2016;44(D1):D733–745. doi:10.1093/nar/gkv1189

18. Jia B, Raphenya AR, Alcock B, et al. CARD 2017: expansion and model-centric curation of the comprehensive antibiotic resistance database. Nucleic Acids Res. 2017;45(D1):D566–d573. doi:10.1093/nar/gkw1004

19. Zankari E, Hasman H, Cosentino S, et al. Identification of acquired antimicrobial resistance genes. J Antimicrob Chemother. 2012;67(11):2640–2644. doi:10.1093/jac/dks261

20. Siguier P, Perochon J, Lestrade L, Mahillon J, Chandler M. ISfinder: the reference centre for bacterial insertion sequences. Nucleic Acids Res. 2006;34(Database issue):D32–36. doi:10.1093/nar/gkj014

21. Moura A, Soares M, Pereira C, Leitão N, Henriques I, Correia A. INTEGRALL: a database and search engine for integrons, integrases and gene cassettes. Bioinformatics. 2009;25(8):1096–1098. doi:10.1093/bioinformatics/btp105

22. Wang P, Jiang X, Mu K, et al. DANMEL: a manually curated reference database for analyzing mobile genetic elements associated with bacterial drug resistance. mLife. 2022;1(4):460–464. doi:10.1002/mlf2.12046

23. Tamura K, Stecher G, Kumar S. MEGA11: molecular evolutionary genetics analysis version 11. Mol Biol Evol. 2021;38(7):3022–3027. doi:10.1093/molbev/msab120

24. CLSI. Performance Standards for Antimicrobial Susceptibility Testing. 32nd ed. CLSI Supplement M100. Clinical and Laboratory Standards Institute; 2022.

25. van Zyl LJ, Deane SM, Rawlings DE. Analysis of the mobilization region of the broad-host-range IncQ-like plasmid pTC-F14 and its ability to interact with a related plasmid, pTF-FC2. J Bacteriol. 2003;185(20):6104–6111. doi:10.1128/JB.185.20.6104-6111.2003

26. Garcillán-Barcia MP, Francia MV, de la Cruz F. The diversity of conjugative relaxases and its application in plasmid classification. FEMS Microbiol Rev. 2009;33(3):657–687. doi:10.1111/j.1574-6976.2009.00168.x

27. Peed L, Parker AC, Smith CJ. Genetic and functional analyses of the mob operon on conjugative transposon CTn341 from Bacteroides spp. J Bacteriol. 2010;192(18):4643–4650. doi:10.1128/JB.00317-10

28. Li J, Zou MX, Wang HC, et al. An outbreak of infections caused by a Klebsiella pneumoniae ST11 clone coproducing Klebsiella pneumoniae carbapenemase-2 and RmtB in a Chinese teaching hospital. Chin Med J (Engl). 2016;129(17):2033–2039. doi:10.4103/0366-6999.189049

29. Wang D, Zhu J, Zhou K, et al. Genetic characterization of novel class 1 Integrons In0, In1069 and In1287 to In1290, and the inference of In1069-associated integron evolution in Enterobacteriaceae. Antimicrob Resist Infect Control. 2017;6:84. doi:10.1186/s13756-017-0241-9

30. Yuan M, Guan H, Sha D, et al. Characterization of bla(KPC-2)-Carrying Plasmid pR31-KPC from a Pseudomonas aeruginosa Strain Isolated in China. Antibiotics (Basel). 2021;10(10). doi:10.3390/antibiotics10101234

31. Haines AS, Jones K, Cheung M, Thomas CM. The IncP-6 Plasmid rms149 consists of a small mobilizable backbone with multiple large insertions. J Bacteriol. 2005;187(14):4728–4738. doi:10.1128/JB.187.14.4728-4738.2005

32. Schlüter A, Szczepanowski R, Kurz N, Schneiker S, Krahn I, Pühler A. Erythromycin resistance-conferring plasmid pRSB105, isolated from a sewage treatment plant, harbors a new macrolide resistance determinant, an integron-containing Tn402-like element, and a large region of unknown function. Appl Environ Microbiol. 2007;73(6):1952–1960. doi:10.1128/AEM.02159-06

33. Bonnin RA, Poirel L, Sampaio JL, Nordmann P. Complete sequence of broad-host-range plasmid pRIO-5 harboring the extended-spectrum-β-lactamase gene blaBES₋₁. Antimicrob Agents Chemother. 2012;56(2):1116–1119. doi:10.1128/AAC.00480-11

34. Naas T, Bonnin RA, Cuzon G, Villegas MV, Nordmann P. Complete sequence of two KPC-harbouring plasmids from Pseudomonas aeruginosa. J Antimicrob Chemother. 2013;68(8):1757–1762. doi:10.1093/jac/dkt094

35. Wang J, Yuan M, Chen H, et al. First report of Klebsiella oxytoca strain simultaneously producing NDM-1, IMP-4, and KPC-2 Carbapenemases. Antimicrob Agents Chemother. 2017;61(9). doi:10.1128/AAC.00877-17

36. Yao Y, Lazaro-Perona F, Falgenhauer L, et al. Insights into a Novel bla(KPC-2)-Encoding IncP-6 plasmid reveal carbapenem-resistance circulation in several Enterobacteriaceae species from wastewater and a hospital source in Spain. Front Microbiol. 2017;8:1143. doi:10.3389/fmicb.2017.01143

37. Hu X, Yu X, Shang Y, et al. Emergence and Characterization of a Novel IncP-6 Plasmid Harboring bla (KPC-2) and qnrS2 Genes in Aeromonas taiwanensis Isolates. Front Microbiol. 2019;10:2132. doi:10.3389/fmicb.2019.02132

38. Dong D, Mi Z, Li D, et al. Novel IncR/IncP6 Hybrid Plasmid pCRE3-KPC Recovered from a Clinical KPC-2-producing citrobacter braakii isolate. mSphere. 2020;5(2). doi:10.1128/mSphere.00891-19

39. Gomi R, Matsumura Y, Tanaka M, et al. Emergence of rare carbapenemases (FRI, GES-5, IMI, SFC and SFH-1) in Enterobacterales isolated from surface waters in Japan. J Antimicrob Chemother. 2022;77(5):1237–1246. doi:10.1093/jac/dkac029

40. Ota Y, Prah I, Nukui Y, Koike R, Saito R. bla(KPC-2)-Encoding IncP-6 plasmids in citrobacter freundii and Klebsiella variicola strains from hospital sewage in Japan. Appl Environ Microbiol. 2022;88(8):e0001922. doi:10.1128/aem.00019-22

41. Kukla R, Chudejova K, Papagiannitsis CC, et al. Characterization of KPC-encoding plasmids from Enterobacteriaceae isolated in a Czech hospital. Antimicrob Agents Chemother. 2018;62(3). doi:10.1128/AAC.02152-17

42. Ghiglione B, Haim MS, Penzotti P, et al. Characterization of emerging pathogens carrying blaKPC-2 Gene in IncP-6 plasmids isolated from Urban Sewage in Argentina. Front Cell Infect Microbiol. 2021;2021:11.

43. Yeo CC, Tham JM, Kwong SM, Yiin S, Poh CL. Tn5563, a transposon encoding putative mercuric ion transport proteins located on plasmid pRA2 of Pseudomonas alcaligenes. FEMS Microbiol Lett. 1998;165(2):253–260. doi:10.1111/j.1574-6968.1998.tb13154.x

44. Yang C, Guo M, Yang H, et al. bla(KPC-24)-harboring Aeromonas veronii from the hospital sewage samples in China. Microbiol Spectr. 2022;10(3):e0055522. doi:10.1128/spectrum.00555-22

Creative Commons License © 2024 The Author(s). This work is published and licensed by Dove Medical Press Limited. The full terms of this license are available at https://www.dovepress.com/terms and incorporate the Creative Commons Attribution - Non Commercial (unported, 3.0) License. By accessing the work you hereby accept the Terms. Non-commercial uses of the work are permitted without any further permission from Dove Medical Press Limited, provided the work is properly attributed. For permission for commercial use of this work, please see paragraphs 4.2 and 5 of our Terms.