Back to Journals » Cancer Management and Research » Volume 12
Long Noncoding RNA LINC00261 Reduces Proliferation and Migration of Breast Cancer Cells via the NME1-EMT Pathway
Received 4 November 2019
Accepted for publication 2 March 2020
Published 4 May 2020 Volume 2020:12 Pages 3081—3089
DOI https://doi.org/10.2147/CMAR.S237197
Checked for plagiarism Yes
Review by Single anonymous peer review
Peer reviewer comments 2
Editor who approved publication: Professor Seema Singh
Guangxiu Guo,* Sujuan Dai,* Qing Chen
Department of Pathology, The People’s Hospital of Ganzhou, Gannan, People’s Republic of China
*These authors contributed equally to this work
Correspondence: Guangxiu Guo
Department of Pathology, The People’s Hospital of Ganzhou, 18 Meiguan Road, Gannan 341000, People’s Republic of China
Email [email protected]
Objective: Long noncoding RNAs (lncRNAs) are emerging as a class of important biological regulators. lncRNAs participate in diverse biological functions and disease processes, especially those leading to tumorigenesis. In this study, we investigate the role of linc00261 in the pathogenesis of breast cancer.
Methods: linc00261 and NME1 expression levels were determined in breast cancer tissue and adjacent normal tissue using qRT-PCR. Cell proliferation and migration were analyzed using MTT and transwell assays, respectively. Epithelial–mesenchymal transition markers were examined via Western blotting assay. RNA pull-down was used to examine the interaction between linc00261 and the NME1 mRNA transcript.
Results: linc00261 is expressed in lower levels on breast cancer tissues than in para-carcinoma tissues. Reintroduction of linc00261 can inhibit the migration of breast cancer cells and arrest their proliferation. Additionally, linc00261 knockdown is sufficient to cause breast carcinoma tumorigenesis. We also found that linc00261 interacts with NME1 mRNA, protecting it from degradation. This protection leads to increased cellular levels of NME1, which functions as suppressor of tumor metastasis.
Conclusion: Taken together, these data demonstrate detailed mechanistic links between the linc00261/NME1 axis and tumorigenesis and show that linc00261 might serve as a novel therapeutic target.
Keywords: linc00261, NME1, breast cancer, E-cadherin, N-cadherin
Introduction
Worldwide, breast cancer is one of the most frequently diagnosed cancers in women. Although advances have been made in breast cancer diagnosis and clinical treatment, the disease remains a major health problem.1–3 In the United States, the average age of patients with breast cancer is lower than that of patients with other commonly occurring cancers including colorectal, lung, and prostate cancers. This is partly because the median age at diagnosis for patients with breast cancer is lower than that for other commonly diagnosed cancers.4,5 Therefore, it is both important and necessary to investigate the etiological mechanisms underlying the onset, development, and progression of breast carcinoma.
Long noncoding RNAs (lncRNAs) are transcripts with more than 200 bps that have no, or minimal, protein coding capacities.6 lncRNAs play important roles in various biological processes.7–9 Increasing evidence indicates that many lncRNAs are dysregulated in cancer and play roles in the development of many features of cancer.10–14 PVT1 is an oncogenic lncRNA, and the PVT1 promoter functions as a tumor-suppressor in breast cancer.15,16 The HOTAIR lncRNAs paly active roles in reprogramming the chromatin state to promote breast cancer metastasis.17 Linc00261, a newly discovered lncRNA, acts as a suppressive regulator in several cancers, such as hepatocellular carcinoma,18 gastric cancer,19 non-small-cell lung cancer,20 and colon cancer21 through various molecular mechanisms. To date, the function of linc00261 in breast cancer has not been reported. In this study, we found that the expression of linc00261 in breast cancer tissue was significantly downregulated compared to para-carcinoma tissues. Functional assays were used to elucidate the influence of linc00261 on cell proliferation and migration. Our results show that linc00261 suppresses the progression of breast cancer by enhancing NME1 mRNA stability.
Patients and Methods
Clinical Samples
This study was approved by the Ethics Committee of the People’s Hospital of Ganzhou. Written informed consent was obtained from each patient, and clinical specimens were collected in accordance with the Declaration of Helsinki. A total of 60 pairs of breast cancer tissues and adjacent non-tumor tissues were harvested from patients at the People’s Hospital of Ganzhou between May 2017 and July 2018. The mean patient age was 49.58 ± 16.59 years. None of the enrolled subjects underwent relevant chemotherapy, radiotherapy, biological therapy, or drug-targeted therapy before surgery. Tissues were stored in liquid nitrogen until required for use.
Cell Cultures and Treatments
MCF7 and MDA-MB-231 cells were obtained from the Chinese Academy of Sciences Cell Bank and cultured in 1640 and MEM medium (Gibco, USA) supplemented with 10% fetal bovine serum at 37°C in an atmosphere containing 5% CO2. Where indicated, cells were treated with 50 µM α-amanitin (Sigma-Aldrich, USA) for 0–24 h.
RNA Extraction and Real-Time qPCR Analysis
Total RNA was isolated using Trizol reagent (Invitrogen; Thermo Fisher Scientific, USA) following the manufacturer’s instructions. RNA was reverse-transcribed into cDNA using M-MLV Reverse Transcriptase (Invitrogen; Thermo Fisher Scientific, USA). Real-time qPCR was performed using the StepOne Real-Time PCR System (Applied Biosystems, Foster City, USA) and SYBR Green (Takara). β-actin expression was measured as an internal control. The primer sequences used were:
Linc00261 forward primer: 5ʹ-TCAGATTGCTCCTGGACACTT-3ʹ,
reverse primer: 5ʹ-GGACCATTGCCTCTTGATTAG-3ʹ;
Snail forward primer: 5ʹ- CTTCGCTGACCGCTCCAACC-3ʹ,
reverse primer: 5ʹ- GGAGCAGGGACATTCGGGAGA-3ʹ;
NME1 forward primer: 5ʹ- CGAGGGGCCTCCTATCTCA-3ʹ,
reverse primer: 5ʹ- ACCAACAAGGCGGAATCCTT-3ʹ;
Slug forward primer: 5ʹ- GGCTCATCTGCAGACCCATT −3ʹ,
reverse primer: 5ʹ- TGCTACACAGCAGCCAGATT −3ʹ;
β-actin forward primer: 5ʹ- AGGCCAACCGCGAGAAGATG-3ʹ,
reverse primer: 3ʹ- CACACGGAGTACTTGCGCTCAG-5ʹ.
Vector Construction and Small Interfering RNA (siRNA/shRNA) Synthesis and Transfection
The cDNA encoding the LINC00261 CDS or antisense CDS was amplified using the Thermo Scientific Phusion Flash High-Fidelity PCR Master Mix (Thermo Fisher Scientific, USA) and subcloned into the EcoRI and XhoI sites of the pcDNA3.1 vector. The sense and antisense constructs were dubbed pcDNA3.1-LINC00261, pcDNA3.1-Antisense, respectively.
The MS2-12× fragment was amplified from pSL-MS2-12× (Addgene) using Phusion Flash High-Fidelity PCR Master Mix (Thermo Fisher Scientific, USA) and subcloned into the EcoRV and XhoI sites of pcDNA3.1 and pcDNA3.1-LINC00261. The MS2 constructs were named pcDNA3.1-MS2, pcDNA3.1-MS2- LINC00261. SiRNAs and shRNAs specifically targeting LINC00261, and control siRNA/shRNA, were synthesized by GenePharma (Table 1). ShRNA was subcloned into the EcoRI and NotI sites of the plv-shRNA vector. Breast cancer cell line was transfected with the plasmids and siRNAs using Lipofectamine 2000, RNAiMAX (Invitrogen) following the manufacturer’s protocol.
|
Table 1 siRNAs/shRNAs Used in This Study |
Cell Proliferation
Cell viability was measured using MTT assays (Sigma-Aldrich, St. Louis, MO, USA). A total of 2000 breast cancer cells (MCF-7 or MDA-MB231 cell line) were seeded into 96-well plates and cultured for 12 h. Cell proliferation was assessed following the manufacturer’s protocol. The absorbance at each time point was plotted to generate cell proliferation curves. These experiments were performed in triplicate.
Transwell Cell Migration Assay
Experiments were performed using a membrane with 8 μm pores (Millipore, Bedford, USA). After transfection, breast cancer cells (MCF-7 or MDA-MB231 cell line) were suspended in serum-free medium, and 2×104 cells were seeded into the upper chamber and cultured at 37°C for 24 h. The lower compartments contained medium supplemented with 10% FBS. After incubation for 24 h, the cells that had migrated to the bottom surface of the membrane were stained with 0.5% crystal violet and examined by an inverted microscope (Olympus, Tokyo, Japan). We randomly selected six fields (magnification 100×) from each sample to calculate the number of cells that had passed through the membrane. These experiments were performed in triplicate.
Western Blotting
Total cell and tissues lysates were collected, lysed using the RIPA reagent (Beyotime, Nanjing, China), and prepared in a 1× sodium dodecyl sulfate buffer. Samples were loaded onto 8% sodium dodecyl sulphate-polyacrylamide gels (20 μg per well) for electrophoresis and then transferred onto nitrocellulose filter membranes. After incubation with E-Cadherin and N-Cadherin (Catalog number 1702–1 and 2447–1, respectively, 1: 1000 dilution, Epitomics, USA) and β-actin (1: 5000; 66,009-1-Ig, Proteintech) primary antibodies, membranes were incubated with secondary antibodies. Secondary antibodies used were goat anti-rabbit IgG and goat anti-mouse IgG (Catalog numbers ZB-2301 and ZB-2305, respectively, 1: 2000 dilution, ZSGB-BIO, China). β-actin was used as a loading control for Western blots.
RNA Immunoprecipitation (RIP-MS2) Assays
pcDNA3.1-MS2 or pcDNA3.1-MS2-Linc00261 constructs were co-transfected into MDA-MB-231 cells with pMS2-GFP (Addgene). After 48 h, RIP experiments were performed using transfected cells, a GFP antibody (3 µg per reaction; ab290, Abcam), and the Magna RIP RNA-Binding Protein Immunoprecipitation Kit (Millipore) following the manufacturer’s instructions.22 The RNA fraction isolated by RIP was quantified using Real-time qPCR.
Nascent RNA Capture
To capture nascent RNAs, 0.2 mM ethylene uridine (EU) was incorporated into MCF-7 cells for 12 h. EU-labeled RNAs were biotinylated and captured using the Click-iT Nascent RNA Capture Kit (Invitrogen) following the manufacturer’s instructions.
Statistical Analysis
Statistical analysis was performed using Graphpad Prism software (La Jolla, CA, USA). Measurement data were expressed as mean ± SD. Differences between groups were analyzed using the t-test. P values <0.05 were considered to indicate significance. Figures are representative of three independent repeats.
Results
linc00261 Expression Is Reduced in Breast Cancer
To explore the function of linc00261 in breast cancer, linc00261 expression levels were determined by examining the extensive tumor transcriptome profiles in The Cancer Genome Atlas. Comparison with expression levels in para-carcinoma tissues revealed that linc00261 expression is significantly downregulated in breast cancer tissues (Figure 1A). To further validate these results, we determined linc00261 expression levels in 60 breast carcinoma tissue pairs. These results show that linc00261 expression is lower in breast carcinoma tissue than in adjacent non-tumor tissues (Figure 1B). Furthermore, low linc00261 expression is observed in patients with advanced breast cancer (Figure 1C) and lymph node metastasis (Figure 1D).
linc00261 Suppresses the Proliferation and Migration of Breast Cancer Cells
We further evaluated whether linc00261 expression correlated with the malignant phenotype in breast carcinoma. Firstly, we examined linc00261 expression levels in various breast cancer cell lines. These results show that linc00261 is highly expressed in MCF7 cells and has low expression levels in MDA-MB-231 cells (Figure S1A). Then, we performed siRNA-mediated linc00261 knockdown in MCF7 cell lines (Figure S1B) and observed a dramatic elevation in their proliferative capacity (Figure 2A). Transwell migration assay results showed that linc00261 knockdown accelerates the migration of breast cancer cells (Figure 2B). Short hairpin RNA (shRNA) for linc00261 knockdown was constructed as another means to silence linc00261 expression (Figure S1C). Lentivirus-mediated shRNA linc00261 knockdown elevated the proliferative ability and migration capacity of cells (Figure 2C and D). Conversely, linc00261 over-expression inhibited breast cancer cell proliferation and migration (Figure 2E and F, S1D). Taken together, these data suggest that linc00261 knockdown increases proliferation and migration in breast cancer cells.
linc00261 Regulates the Epithelial–Mesenchymal Transition (EMT) in Breast Cancer Cells
Despite recent advances in diagnosis and treatment, as a result of metastasis and consequent recurrence after curative therapies, breast carcinoma remains a highly lethal disease. In gastric cancer, linc00261 suppresses growth and metastasis by repressing the EMT.19 The hallmarks of the EMT are decreased E-cadherin expression and increased N-cadherin expression. Therefore, we examined whether linc00261 affects EMT in breast cancer cells. Our results show that E-cadherin expression is decreased and N-cadherin expression increased following linc00261 knockdown (Figure 3A). Consistent with this, E-cadherin expression increased and N-cadherin expression decreased when linc00261 is overexpressed in breast cancer cells (Figure 3A). These results show that linc00261 inhibits the EMT in breast cancer. We further explored how linc00261 regulated the EMT during breast cancer pathogenesis. NME1 is a metastasis suppressor gene implicated as an important EMT regulator. Interestingly, linc00261 knockdown significantly inhibit NME1 mRNA expression (Figure 3B). Furthermore, linc00261 overexpression can inhibit the expression of the important EMT regulators snail and twist (Figure 3B).
linc00261 Regulates EMT by Enhancing NME1 mRNA Stability
To elucidate the mechanisms underlying the effect of linc00261 on the EMT, we asked whether linc00216 binds with an EMT marker using immunoprecipitation (IP). MS2-RIP experiment results reveal that linc00261 interacts with NME1 mRNA, but not with snail, twist, E-cadherin, or N-cadherin mRNA (Figure 4A). We used in vitro transcribed biotin-labelled NME1 to further validate that NME1 pulls down endogenous linc00261 mRNA (Figure 4B). These results indicate that linc00261 may regulate NME1 mRNA stability. We transiently expressed linc00261 in breast cancer cells treated with a-amanitin to block the synthesis of RNA and measured the NME1 mRNA loss (Figure 4C). linc00261 increases the half-life of NME1 mRNA (Figure 4C) and NME1 mRNA half-life decreases after linc00261 knockdown (Figure S2A). These results suggest that linc00261 is required for the regulation of NME1 mRNA stability. Furthermore, newly synthesized nascent NME1 mRNA levels were measured in shLinc00261 cells and control cells. We found that linc00261 does not influence NME1 gene transcription synthesis (Figure S2B). Assessment of NME1 expression in 60 breast carcinoma tissues revealed a positive correlation with linc00261 expression (R2 = 0.6393, p < 0.001) (Figure S2C). Importantly, NME1 overexpression completely suppressed the proliferation ability and EMT phenotype caused by linc00261 silencing (Figure 4D and E, S1E). Additionally, silencing NME1 disrupted linc00261 overexpression-mediated tumor suppression (Figure S1F,S3A and B). These data show that linc00261 suppresses the EMT process by enhancing NME1 mRNA stability, preventing breast carcinoma tumorigenesis.
Discussion
In this study, we identified a tumor suppressor lncRNA, linc00261. linc00261 is located on chromosome 20, spanning sites 22,560,552 to 22,578,642.23 LINC00261 has been identified as a tumor suppressor in various cancers, and a novel prognostic marker,24,25 for example, in patients with lung cancer.26–28 Here, for the first time, we report that linc00261 expression is significantly decreased in breast cancer tissues and cells. Furthermore, we show that LINC00261 inhibits breast cancer by competitively binding to NME1 mRNA, a critical step in mediating the progression of breast cancer. Our functional studies show that linc00261 significantly drives, and is necessary for, NME1 mRNA stability. We also identified a mechanistic link between linc00261 and breast carcinoma tumorigenesis.
NME1 is a well-known tumor suppressor that regulates p53 function to prevent cancer progression and metastasis in some malignancies.29–32 NME1 is involved in cell-adhesion-related signaling pathways, and may play an important role in growth control, cellular proliferation, signal transduction, embryonic development, and differentiation.33–36 lncRNAs are known to be involved in a variety of biological functions, such as regulating local chromatin structure, gene expression, mRNA levels, and protein binding for posttranscriptional modification.9,37-39 However, the mechanism through which lncRNA regulates NME1 is unknown. In our study, we found that linc00261 interacts with NME1 mRNA and stabilizes NEM1 expression. We also showed that linc00261 has no effect on NME1 transcript synthesis, and only inhibits the NME1 mRNA degradation pathway. Therefore, the interaction between NME1 mRNA and linc00261 may result in a positive regulatory effect on breast carcinoma tumorigenesis.
In summary, our results show that linc00261 can inhibit the progression of breast cancer cells by enhancing NME1 mRNA stability. Here, we have shown a mechanistic link between the linc00261-NME1 axis and tumorigenesis, and demonstrated that linc00261 may be an attractive therapeutic target for breast carcinoma treatment.
Abbreviations
Linc00261, long intergenic noncoding RNA-00261; NME1, NME/NM23 Nucleoside Diphosphate Kinase 1; EMT, epithelial–mesenchymal transition.
Ethics and Consent Statement
Informed consent was obtained from all individual participants included in the study. All procedures involving humans were performed in accordance with the ethical standards of the institution or practice at which the studies were conducted.
Disclosure
The authors report no conflicts of interest in this work.
References
1. Anastasiadi Z, Lianos GD, Ignatiadou E, Harissis HV, Mitsis M. Breast cancer in young women: an overview. Updates Surg. 2017;69(3):313–317. doi:10.1007/s13304-017-0424-1
2. Miller KD, Nogueira L, Mariotto AB, et al. Cancer treatment and survivorship statistics, 2019. CA Cancer J Clin. 2019;69(5):363–385. doi:10.3322/caac.21565
3. Li Q, Seo JH, Stranger B, et al. Integrative eQTL-based analyses reveal the biology of breast cancer risk loci. Cell. 2013;152(3):633–641. doi:10.1016/j.cell.2012.12.034
4. DeSantis CE, Fedewa SA, Goding Sauer A, Kramer JL, Smith RA, Jemal A. Breast cancer statistics, 2015: convergence of incidence rates between black and white women. CA Cancer J Clin. 2016;66(1):31–42. doi:10.3322/caac.21320
5. DeSantis CE, Ma J, Goding Sauer A, Newman LA, Jemal A. Breast cancer statistics, 2017, racial disparity in mortality by state. CA Cancer J Clin. 2017;67(6):439–448. doi:10.3322/caac.21412
6. de Oliveira JC, Oliveira LC, Mathias C, et al. Long non-coding RNAs in cancer: another layer of complexity. J Gene Med. 2019;21(1):e3065.
7. Clark MB, Mercer TR, Bussotti G, et al. Quantitative gene profiling of long noncoding RNAs with targeted RNA sequencing. Nat Methods. 2015;12(4):339–342. doi:10.1038/nmeth.3321
8. Salviano-Silva A, Lobo-Alves SC, Almeida RC, Malheiros D, Petzl-Erler ML. Besides pathology: long non-coding RNA in cell and tissue homeostasis. Noncoding RNA. 2018;4(1):3. doi:10.3390/ncrna4010003
9. Quinn JJ, Chang HY. Unique features of long non-coding RNA biogenesis and function. Nat Rev Genet. 2016;17(1):47–62. doi:10.1038/nrg.2015.10
10. Wang J, Zhang X, Chen W, Hu X, Li J, Liu C. Regulatory roles of long noncoding RNAs implicated in cancer hallmarks. Int J Cancer. 2020;146(4):906–916.
11. Yan X, Hu Z, Feng Y, et al. Comprehensive genomic characterization of long non-coding RNAs across human cancers. Cancer Cell. 2015;28(4):529–540. doi:10.1016/j.ccell.2015.09.006
12. Flippot R, Beinse G, Boileve A, Vibert J, Malouf GG. Long non-coding RNAs in genitourinary malignancies: a whole new world. Nat Rev Urol. 2019;16(8):484–504. doi:10.1038/s41585-019-0195-1
13. Tang Y, Cheung BB, Atmadibrata B, et al. The regulatory role of long noncoding RNAs in cancer. Cancer Lett. 2017;391:12–19. doi:10.1016/j.canlet.2017.01.010
14. Schmitt AM, Chang HY. Long noncoding RNAs in cancer pathways. Cancer Cell. 2016;29(4):452–463. doi:10.1016/j.ccell.2016.03.010
15. Cho SW, Xu J, Sun R, et al. Promoter of lncRNA Gene PVT1 is a tumor-suppressor DNA boundary element. Cell. 2018;173(6):1398–1412.e22. doi:10.1016/j.cell.2018.03.068
16. Tang J, Li Y, Sang Y, et al. LncRNA PVT1 regulates triple-negative breast cancer through KLF5/beta-catenin signaling. Oncogene. 2018;37(34):4723–4734. doi:10.1038/s41388-018-0310-4
17. Gupta RA, Shah N, Wang KC, et al. Long non-coding RNA HOTAIR reprograms chromatin state to promote cancer metastasis. Nature. 2010;464(7291):1071–1076. doi:10.1038/nature08975
18. Zhang HF, Li W, Han YD. LINC00261 suppresses cell proliferation, invasion and notch signaling pathway in hepatocellular carcinoma. Cancer Biomark. 2018;21(3):575–582. doi:10.3233/CBM-170471
19. Yu Y, Li L, Zheng Z, Chen S, Chen E, Hu Y. Long non-coding RNA linc00261 suppresses gastric cancer progression via promoting slug degradation. J Cell Mol Med. 2017;21(5):955–967. doi:10.1111/jcmm.13035
20. Shi J, Ma H, Wang H, et al. Overexpression of LINC00261 inhibits non-small cell lung cancer cells progression by interacting with miR-522-3p and suppressing Wnt signaling. J Cell Biochem. 2019;120(10):18378–18387. doi:10.1002/jcb.29149
21. Yan D, Liu W, Liu Y, Luo M. LINC00261 suppresses human colon cancer progression via sponging miR-324-3p and inactivating the Wnt/beta-catenin pathway. J Cell Physiol. 2019. doi:10.1002/jcp.28831
22. Yuan JH, Liu XN, Wang TT, et al. The MBNL3 splicing factor promotes hepatocellular carcinoma by increasing PXN expression through the alternative splicing of lncRNA-PXN-AS1. Nat Cell Biol. 2017;19(7):820–832. doi:10.1038/ncb3538
23. Zhao J, Liu Y, Zhang W, et al. Long non-coding RNA Linc00152 is involved in cell cycle arrest, apoptosis, epithelial to mesenchymal transition, cell migration and invasion in gastric cancer. Cell Cycle. 2015;14(19):3112–3123. doi:10.1080/15384101.2015.1078034
24. Zhang B, Li C, Sun Z. Long non-coding RNA LINC00346, LINC00578, LINC00673, LINC00671, LINC00261, and SNHG9 are novel prognostic markers for pancreatic cancer. Am J Transl Res. 2018;10(8):2648–2658.
25. Muller S, Raulefs S, Bruns P, et al. Next-generation sequencing reveals novel differentially regulated mRNAs, lncRNAs, miRNAs, sdRNAs and a piRNA in pancreatic cancer. Mol Cancer. 2015;14(1):94. doi:10.1186/s12943-015-0358-5
26. Davalos V, Esteller M. Disruption of long noncoding RNAs targets cancer hallmark pathways in lung tumorigenesis. Cancer Res. 2019;79(12):3028–3030. doi:10.1158/0008-5472.CAN-19-0910
27. Dhamija S, Becker AC, Sharma Y, Myacheva K, Seiler J, Diederichs S. LINC00261 and the adjacent gene FOXA2 are epithelial markers and are suppressed during lung cancer tumorigenesis and progression. Noncoding RNA. 2018;5(1):2.
28. Shahabi S, Kumaran V, Castillo J, et al. LINC00261 is an epigenetically regulated tumor suppressor essential for activation of the DNA damage response. Cancer Res. 2019;79(12):3050–3062. doi:10.1158/0008-5472.CAN-18-2034
29. Feng HH, Zhu ZX, Cao WJ, et al. Foot-and-mouth disease virus induces lysosomal degradation of NME1 to impair p53-regulated interferon-inducible antiviral genes expression. Cell Death Dis. 2018;9(9):885. doi:10.1038/s41419-018-0940-z
30. Wang Y, Leonard MK, Snyder DE, Fisher ML, Eckert RL, Kaetzel DM. NME1 drives expansion of melanoma cells with enhanced tumor growth and metastatic properties. Mol Cancer Res. 2019;17(8):1665–1674.
31. Lim J, Jang G, Kang S, et al. Cell-permeable NM23 blocks the maintenance and progression of established pulmonary metastasis. Cancer Res. 2011;71(23):7216–7225. doi:10.1158/0008-5472.CAN-11-2015
32. Boissan M, De Wever O, Lizarraga F, et al. Implication of metastasis suppressor NM23-H1 in maintaining adherens junctions and limiting the invasive potential of human cancer cells. Cancer Res. 2010;70(19):7710–7722. doi:10.1158/0008-5472.CAN-10-1887
33. Takács-Vellai K. The metastasis suppressor Nm23 as a modulator of Ras/ERK signaling. J Mol Signal. 2014;9:4. doi:10.1186/1750-2187-9-4
34. Tso PH, Wang Y, Yung LY, Tong Y, Lee MM, Wong YH. RGS19 inhibits ras signaling through Nm23H1/2-mediated phosphorylation of the kinase suppressor of ras. Cell Signal. 2013;25(5):1064–1074. doi:10.1016/j.cellsig.2013.02.010
35. Lim JQR, Lu J, He BP. Diva/BclB regulates differentiation by inhibiting NDPKB/Nm23H2-mediated neuronal differentiation in PC-12 cells. BMC Neurosci. 2012;13(1):123. doi:10.1186/1471-2202-13-123
36. Amrein L, Barraud P, Daniel J-Y, Pérel Y, Landry M. Expression patterns of nm23 genes during mouse organogenesis. Cell Tissue Res. 2005;322(3):365–378. doi:10.1007/s00441-005-0036-9
37. Engreitz JM, Haines JE, Perez EM, et al. Local regulation of gene expression by lncRNA promoters, transcription and splicing. Nature. 2016;539(7629):452–455. doi:10.1038/nature20149
38. Fanucchi S, Fok ET, Dalla E, et al. Immune genes are primed for robust transcription by proximal long noncoding RNAs located in nuclear compartments. Nat Genet. 2019;51(1):138–150. doi:10.1038/s41588-018-0298-2
39. Kopp F, Mendell JT. Functional classification and experimental dissection of long noncoding RNAs. Cell. 2018;172(3):393–407. doi:10.1016/j.cell.2018.01.011
© 2020 The Author(s). This work is published and licensed by Dove Medical Press Limited. The
full terms of this license are available at https://www.dovepress.com/terms
and incorporate the Creative Commons Attribution
- Non Commercial (unported, 3.0) License.
By accessing the work you hereby accept the Terms. Non-commercial uses of the work are permitted
without any further permission from Dove Medical Press Limited, provided the work is properly
attributed. For permission for commercial use of this work, please see paragraphs 4.2 and 5 of our Terms.
