Back to Journals » Infection and Drug Resistance » Volume 16
Association of Single-Nucleotide Polymorphisms in the VDR Gene with Tuberculosis and Infection of Beijing Genotype Mycobacterium tuberculosis
Authors Yu J, Liu M, Mijiti X, Liu H
, Wang Q, Yin C, Anwaierjiang A, Xu M, Li M, Deng L, Xiao H, Zhao X, Wan K, Li G, Yuan X
Received 8 February 2023
Accepted for publication 3 May 2023
Published 22 May 2023 Volume 2023:16 Pages 3157—3169
DOI https://doi.org/10.2147/IDR.S407595
Checked for plagiarism Yes
Review by Single anonymous peer review
Peer reviewer comments 2
Editor who approved publication: Professor Suresh Antony
Jinjie Yu,1,2,* Mengwen Liu,3,* Xiaokaiti Mijiti,4,* Haican Liu,2,* Quan Wang,4 Chunjie Yin,3 Aiketaguli Anwaierjiang,5 Miao Xu,4 Machao Li,2 Lele Deng,2,6 Hui Xiao,3 Xiuqin Zhao,2 Kanglin Wan,2 Guilian Li,2 Xiuqin Yuan1
1School of Public Health, University of South China, Hengyang, 421001, People’s Republic of China; 2State Key Laboratory for Infectious Disease Prevention and Control, Collaborative Innovation Center for Diagnosis and Treatment of Infectious Diseases, National Institute for Communicable Disease Control and Prevention, Chinese Center for Disease Control and Prevention, Beijing, 102206, People’s Republic of China; 3School of Public Health, Xinjiang Medical University, Urumqi, Xinjiang, 830011, People’s Republic of China; 4The Eighth Affiliated Hospital of Xinjiang Medical University, Urumqi, Xinjiang, 830049, People’s Republic of China; 5College of Xinjiang Uyghur Medicine, Hetian, 848000, People’s Republic of China; 6National Institute for Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention, Beijing, People’s Republic of China
*These authors contributed equally to this work
Correspondence: Xiuqin Yuan, School of Public Health, University of South China, Hengyang, 421001, People’s Republic of China, Email [email protected];Guilian Li, State Key Laboratory for Infectious Disease Prevention and Control, Collaborative Innovation Center for Diagnosis and Treatment of Infectious Diseases, National Institute for Communicable Disease Control and Prevention, Chinese Center for Disease Control and Prevention, Beijing, 102206, People’s Republic of China, Email [email protected]
Background: The aim of the present study was to investigate the association between vitamin D receptor (VDR) gene polymorphism and tuberculosis susceptibility, as well as the potential interaction of host genetic factors with the heterogeneity of Mycobacterium tuberculosis in the population from Xinjiang, China.
Methods: From January 2019 to January 2020, we enrolled 221 tuberculosis patients as the case group and 363 staff with no clinical symptoms as the control group from four designated tuberculosis hospitals in southern Xinjiang, China. The polymorphisms of Fok I, Taq I, Apa I, Bsm I, rs3847987 and rs739837 in the VDR were detected by sequencing. M. tuberculosis isolates were collected from the case group and identified as Beijing or non-Beijing lineage by multiplex PCR. Propensity score (PS), univariate analysis and multivariable logistic regression models were used to perform the analysis.
Results: Our results showed that the allele and genotype frequencies of Fok I, Taq I, Apa I, Bsm I, rs3847987 and rs739837 in VDR were not correlated with tuberculosis susceptibility or lineages of M. tuberculosis. Two out of six loci of the VDR gene formed one haplotype block, and none of the haplotypes was found to correlate with tuberculosis susceptibility or lineages of M. tuberculosis infected.
Conclusion: Polymorphisms in the VDR gene may not indicate susceptibility to tuberculosis. There was also no evidence on the interaction between the VDR gene of host and the lineages of M. tuberculosis in the population from Xinjiang, China. Further studies are nonetheless required to prove our conclusions.
Keywords: vitamin D receptor, VDR, polymorphism, tuberculosis, Mycobacterium tuberculosis, Beijing lineage
Introduction
Prior to the new coronavirus (COVID-19) pandemic, tuberculosis was the leading cause of death from a single infectious disease. About 10.6 million new cases of tuberculosis, with an incidence rate of 134 per 100,000, of which 6.6% were co-infected with human immunodeficiency virus (HIV), and an estimated 1.6 million deaths from tuberculosis were reported globally in 2021.1 Tuberculosis is an infectious disease caused by the bacillus Mycobacterium tuberculosis complex, which is spread mainly from person to person through the respiratory pathway. At present, about a quarter of the world’s population is infected with M. tuberculosis. For these people, the lifetime risk of developing tuberculosis is about 5–10%,1 which reflects the genetic differences in human susceptibility to active and latent tuberculosis.2
It has been reported that host and pathogen have evolved mechanisms and relationships that greatly influence the outcome of infection,3 and innate immunity-related genes of the host genome provide a good model for studying the selection pressure exerted by microorganisms.4 For example, the vitamin D (1,25-dihydroxyvitamin D3) nuclear receptor (vitamin D receptor, VDR), a trans-acting transcription factor, mediates the innate immune response by enhancing the expression of several antimicrobial peptides and participates in the elimination process of M. tuberculosis.5 By interacting with VDR, vitamin D could promote phagolysosome fusion and autophagy while inducing anti-inflammatory cytokine secretion that prevents excessive lung pathology and then counteracts multiple virulence mechanisms used by M. tuberculosis to evade the host immune response and establish infection.3
The VDR gene is located on chromosome 12q13.11, and its Mendelian Inheritance Database (OMIM) number is 601769, including multiple single-nucleotide polymorphism sites such as FokI, TaqI, ApaI and BsmI. Previous literature shows that VDR gene polymorphisms can affect the host’s susceptibility to tuberculosis and the pharmacokinetic levels of first-line antitubercular drugs,5–7 but the results did not reach a consensus in distinct ethnic groups. Sha et al8 found that Bsm I-Bb and bb genotypes and Fok I-Ff and ff genotypes in VDR gene increasing the risk of tuberculosis susceptibility in adolescents. Zhang et al9–11 found that the allele f and the genotype ff in the Fok I were respectively associated with tuberculosis susceptibility in the Kazakh and in the Han population; no correlation was observed between the Taq I locus polymorphism and tuberculosis susceptibility in the Kazakh, Uyghur and Han populations in Xinjiang. The above studies classified the allele genes and genotypes according to PCR amplification product digestion – gel electrophoresis imaging, which provided clues on the associations between VDR polymorphism and tuberculosis susceptibilities. Xu12 conducted a meta-analysis of 42 studies and found that the variation of the VDR gene BsmI and TaqI sites was significantly associated with tuberculosis, and further subgroup analysis by race showed that both BsmI and TaqI site variations were associated with tuberculosis in South Asians, inconsistent with Wang‘s13 meta-analysis of 54 studies. We speculated that only investigating the polymorphic variants of human genes without considering the factors from pathogens made above researches less repeatable.
Previous studies showed that the Beijing lineage of M. tuberculosis is the most prevalent in the national wide of China.14,15 However, lineage distributions of M. tuberculosis and ethnic distributions of tuberculosis patients have been reported to be variable in different geographic locations in China.15–17 For example, the ratio of Beijing family strains in northern provinces is much higher than that in southern provinces.15 Compared with the neighboring provinces, such as Tibet, Gansu and Inner Mongolia, the proportion of Beijing family in Xinjiang is obviously lower.16,17 It is unclear whether VDR gene polymorphisms affect the geographical transmission of M. tuberculosis with different lineages, and it would be helpful to clarify the susceptibility mechanism to tuberculosis in Xinjiang, China, by combining the lineage of M. tuberculosis with the polymorphic variants of the human VDR gene. The purpose of this study was to evaluate six single-nucleotide polymorphisms (SNPs) Fok I (rs2228570), Taq I (rs731236), Apa I (rs7975232), Bsm I (rs1544410), rs3847987 and rs739837 in the VDR and their potential interaction with M. tuberculosis lineage in the population from Xinjiang.
Methods
Ethical Approval
This study was approved by the Ethics Committee of the Eighth Affiliated Hospital of Xinjiang Medical University (XJMU8HEC-20161215). The patients with tuberculosis and healthy staff in the designated hospitals were included in the present study only after we obtained written informed consent from themselves, or from their parents/guardians in cases where the patient was a child (≤18 years of age).
Estimation of Sample Size
Sample size was estimated based on a minimum allele frequency (MAF) of 20% for the smaller Taq I locus with an expected OR of 2.5, α=0.05 (bilateral) and β=0.20 for an unpaired case–control study. The sample size required for the case and control groups was estimated to be at least 126 individuals per group, calculated using PASS 15.0 software (NSCC, USA).
Participants
From January 2019 to January 2020, the tuberculosis patients were enrolled consecutively in four designated tuberculosis hospitals in Xinjiang (ie, the Eighth Affiliated Hospital of Xinjiang Medical University, Kashgar Pulmonary Hospital, Kuqa County Infectious Disease Hospital and Wushi County People’s Hospital) and their basic information were recorded. All cases were in compliance with the tuberculosis diagnosis criteria issued by the National Health and Family Planning Commission of the People’s Republic of China.18,19 Patients with HIV-positive or severe primary diseases were not included in this study.
The control group consisted of the staff in these hospitals with no clinical symptoms. They were confirmed to have negative TSPOT.TB results.
Specimen Collection and DNA Extraction
After all participants signed the informed consent forms and joined the study, 5 ml of venous blood from each participant were collected in EDTA anticoagulant tubes. The nucleic acid extraction kit (magnetic bead method) and AU1001-96 automatic nucleic acid extractor provided by Bio teke Biotechnology Corporation, Wuxi, China, were then used to extract DNA from the blood samples. A total of 65 clinical isolates of M. tuberculosis from the case group were collected, and their genomic DNA was extracted through the cetyltrimethylammonium bromide (CTAB) method.20 All extracted DNA was quantitated by spectrophotometry using the NanoDrop One (Thermo Scientific, Massachusetts, USA) and stored at −20°C until analyzed.
Single-Nucleotide Polymorphism of VDR Gene
The six polymorphic SNPs Fok I, Taq I, Apa I, Bsm I, rs3847987 and rs739837 in VDR gene were studied to find out whether the polymorphisms are associated with tuberculosis susceptibility, and their specific information can be seen at Table 1. The primers were synthesized by Beijing Tianyi Huiyuan Biotechnology Co., Ltd, Beijing, China, and the sequences were as follows: 5’-ATCATGTATGAGGGCTCCGAAG-3’ and 5’-GCCGCATGTTCCATGGACATTG-3’ for Fok I, 5’-AAGGGGCGTTAGCTTCATGC-3’ and 5’-TCACCGGTCAGCAGTCATAGA-3’ for Taq I and Apa I, 5’-CGGAAGAGGTCAAGGGTCAC-3’ and 5’-CCTGAAGGGAGACGTAGCAA-3’ for Bsm I, 5’-GTGCTCCAGTGATGGGAAGA-3’ and 5’- GCTTTTCCCCGGTCCCTTGA-3’ for rs3847987 and rs739837. The total volume of the PCR was 25 µL, including 12.5 µL PCR mixture, 1 µL DNA, 10 ng upstream primer, 10 ng downstream primer and 9.5 µL ddH2O. PCR conditions were 95°C for 3 min, followed by 35 cycles of 95°C for 30s, 62.1°C (Fok I) or 61.3°C (Taq I and Apa I) or 62.5°C (Bsm I) or 61.8°C (rs3847987 and rs739837) for 30s, and 72°C for 30s, and finally extension at 72°C for 7 min. The amplified products were purified and sequenced on ABI 3730xl DNA Sequencer by Beijing Tianyi Huiyuan Biotechnology Co., Ltd., Beijing, China.
|
Table 1 Information of Six SNPs in VDR Gene |
Identification of Beijing Lineage in 65 Mycobacterium tuberculosis Isolates
An improved multiplex PCR method was used to identify the Beijing genotype from the non-Beijing lineage in the 65 M. tuberculosis isolated from the case group in this study.21 Two pairs of PCR primers were designed according to the reference literature.21 Beijing was ACCGAGCTGATCAAACCCG and ATGGCACGGCCGACCTGAATGAACC (GenBank Accession number AF390039) and non-Beijing was GGTGCGAGATTGAGGTTCCC and TCTACCTGCAGTCGCTTGTGC (Genebank Accession number BX842581). The lengths of the amplified fragments were 239bp and 308bp, respectively. The PCR products were verified by 1.5% agarose gel electrophoresis, and gel imager (Bio-Rad ChemiDoc XRS+ imaging system) was then used to observe the results.
Statistical Analysis
All analyses were performed by SPSS 25.0 (SPSS Inc., Chicago, IL, USA). The age was presented by median and interquartile range [M (P25, P75)] and grouped into <45 and ≥45 years. The categorical variables were described by frequency and percentage [n (%)]. The χ2 test or Fisher’s exact test was used for categorical variables.
Hardy–Weinberg equilibrium (HWE) was tested by Excel in the control group.22 Propensity score (PS) matching on the baseline characteristics and potential confounders implemented a 0.1 caliper logistic model with nearest neighbor 1:1 or 1:2 matching. The balance assessment was conducted by computing absolute standardized mean differences (SMDs) and SMD < 0.10 reflects good balance between groups. Linkage disequilibrium (LD) among the six SNPs was analyzed using the LD plot function of Haploview (version 4.2) and was assessed by using D’ and r2 values obtained through this software.23 The stronger LD was defined between two SNPs with values of D’ or r2 closer to one. Haploview (version 4.2) was also used to generate haplotypes of SNPs in the blocks. A multivariable logistic analysis was used to study the relationships of alleles, genotypes, haplotypes and demographic factors with tuberculosis status as applicable. The statistical significance was established at P < 0.05.
Results
Demographic Characteristics
Two hundred and twenty-one tuberculosis patients as the case group and 363 healthy staff as the control group were included in this study. The differences in gender and age between the two groups were statistically significant (both P values <0.05). Studies have shown that gender and age are also factors influencing the incidence of tuberculosis.1,24 In the following analysis, multivariable logistic regression analysis and PS were used to control the effect of these factors on the real relationship between VDR polymorphisms and tuberculosis susceptibility. Other detailed demographic characteristics of participants are shown in Table 2.
|
Table 2 Demographic Characteristics of the Research Objects |
HWE Testing
The results showed that the distributions of VDR Fok I, Taq I, Apa I, Bsm I, rs3847987 and rs739837 genotypes in the control group conformed to the HWE in genetic inheritance (P > 0.05), which suggested that the control group is representative of the studying population, as shown in Table 3.
|
Table 3 The Distributions of the VDR Genotypes and HWE Testing in the Control Group |
Association Analysis of VDR Gene Polymorphisms and Susceptibility to Tuberculosis
Univariate Analysis on the Associations Between the Alleles and Genotypes of Four Loci and Susceptibility to Tuberculosis
For the whole subjects, the results of the univariate analysis showed that none of the alleles or genotypes of six loci were statistically associated with susceptibility to tuberculosis (Table 4), whilst Taq I genotype distribution showed a potent relationship with tuberculosis status (P = 0.087).
|
Table 4 Univariate Analysis of VDR Gene Polymorphisms and Susceptibility to Tuberculosis |
We also used PS with nearest neighbor 1:1 matching to control the effect attributed to age and gender between the two groups, and 105 subjects were included in each group after matching. Among these subjects, the SMD values of each covariate (age and gender) were less than 0.10, indicating a good balance between the groups and good propensity score matching. The results of univariate analysis among subjects after matching showed no statistically significant differences in the distribution of VDR gene polymorphisms between the two groups (Table 4).
The Linkage Disequilibrium and Haplotype Analysis
The D’ and r2 values acquired by LD analysis with Haploview among the six SNPs in VDR were shown in Table 5, and one block involving rs3847987 and rs739837 was found (Figure 1). Haplotype analysis of the two selected SNPs was also performed using Haploview. A total of three haplotypes were generated; however, none of which were found to be associated with a significantly increased risk of tuberculosis (Table 6).
|
Table 5 Linkage Disequilibrium Test for SNPs of VDR Gene |
|
Table 6 Haplotype Distributions of rs3847987 and rs739837 in the Case and Control Groups After PS |
|
Figure 1 Linkage disequilibrium test for SNPs of VDR gene. (A) D’ values between each two loci, and (B) r2 values between each two loci. |
Multivariable Logistic Regression Analysis
In the present study, we only found that Taq I genotype distribution showed a potent relationship with tuberculosis status (P = 0.087) on the whole subject, and further combined factors of gender and age for the multivariable logistic regression analysis. The results did not reveal an association between Taq I polymorphisms and susceptibility to tuberculosis (Table 7).
|
Table 7 Multivariable Logistic Regression Analysis of VDR Gene Polymorphisms and Susceptibility to Tuberculosis Among the Whole Subjects |
The Relationship Between Host’s VDR Polymorphisms and Mycobacterial Lineage
Previous reports show that the host and the pathogen may have co-adaptation. The host’s susceptibility to tuberculosis may also depend on the interaction between the host and mycobacterial lineages.25–27 In the present study, we classified the patient’s M. tuberculosis isolates as Beijing and non-Beijing lineages, and then analyzed the relationship between polymorphisms of VDR gene and the lineages of M. tuberculosis that the host infected with. Here, we also used PS with nearest neighbor 1:2 matching to control the imbalance of age and gender between the groups and got a SMD values less than 0.10, finally, 56 subjects in the control group were included to perform analysis.
Lineage Identification of Mycobacterium tuberculosis
Sixty-five isolates of M. tuberculosis were collected from the case group, of which 32 (49.2%) were Beijing lineage and 33 (50.8%) were non-Beijing lineage.
The Association Between Polymorphisms of VDR Gene and Lineages of Mycobacterium tuberculosis
As shown in Table 8, the distributions of the genotypes and alleles of Fok I, Taq I, Apa I, Bsm I, rs3847987 and rs739837 in the VDR gene between patients infected with Beijing lineage and non-Beijing lineage and control group were not found to be statistically different. Further haplotype analysis was used, and the results showed that there were linkage disequilibria among the two SNPs rs3847987 and rs739837 (Supplemental Figures S1–S3). Although no statistically significant associations were observed in haplotype, they constitute and tuberculosis susceptibility (Supplemental Tables S1–S3).
|
Table 8 The Associations Between Polymorphisms of VDR Gene and Lineages of M. tuberculosis in the Population After PS |
Discussion
This is the first report on the interaction between the VDR gene polymorphisms of population of China and the lineage of M. tuberculosis. Previous studies show that variants in human genes TLR2,28 SLC11A1,29 CD53,30 G57E31 and LAMP132 have correlations with M. tuberculosis lineage, implying co-evolution between humans and M. tuberculosis. In this study, we tried to find correlations between the Fok I, Taq I, Apa I, Bsm I, rs3847987 or rs739837 polymorphisms of VDR gene of population in southern Xinjiang and the occurrence of tuberculosis or the lineages of M. tuberculosis infected. However, no significant link was found.
With the improvement and availability of gene sequencing technology, a large number of disease-related susceptibility genes have been discovered. Genes related to tuberculosis susceptibility have been reported continuously through genome-wide association studies (GWAS) and hot SNP correlation studies, including human leukocyte antigen (HLA) genes and non-HLA genes like NRAMP1, VDR, SP110, etc. A study among twins shown that the consistency of tuberculosis in identical twins is significantly higher than that in fraternal twins,33 indicating that genetic susceptibility is one of the important risk factors for developing active tuberculosis, even within the same race. However, reports on the genes or SNPs associated with making human beings susceptible to tuberculosis development were inconsistent or contradictory due to the geographical restrictions and ethnic differences.5,25,34 There were few reports on the susceptibility genes of tuberculosis in population from Xinjiang, China.9,10,35
Observational studies in recent years have found that vitamin D has an anti-tuberculosis effect in vitro, with reduced proliferation of M. tuberculosis in vitamin D-treated macrophages.36 The mechanism may be that Toll-like receptors on macrophages are activated by M. tuberculosis, which in turn induces upregulation of vitamin receptor transcription and enhances CYP27B1 expression. CYP27B1 promotes increased synthesis of 1,25(OH)2 D3, which in combination with VDR is involved in regulating the expression of various genes, including the secretion of some cytokines and the expression of antimicrobial peptides, thereby increasing the killing power of macrophages against M. tuberculosis.37,38 However, the diversity of genetic backgrounds and survival environments in different populations may lead to a diversity of various genotypes and allele frequencies of VDR, and therefore the role of VDR gene polymorphisms in different populations varies.
In the present study, 221 tuberculosis patients and 363 healthy controls from southern Xinjiang were selected to explore the polymorphisms of VDR associated with tuberculosis. The results showed that the distribution frequencies of alleles and genotypes of Fok I, Taq I, Apa I, Bsm I, rs3847987 and rs739837 in patients were not statistically different from that of the control group, which was inconsistent with the previously reported results.5,6,39 For example, Sharma et al reported that Bsm I polymorphism appeared associated with the tuberculosis in tribes, castes and Muslims of central India, whereas, Taq I, Fok I and Apa I polymorphisms revealed association in general population and Muslims only.40 The report in the Brazilian population found that Taq I-TT genotypes, Fok I-CC/(CC+CT) and Bsm I-GG genotypes were significantly associated with tuberculosis susceptibility, of which the homozygotes of Taq I-TT and Bsm I-GG both have approximately twofold increase in risk ratio than other genotypes.5 Similarly, Taq I-TT was also found to be a risk factor in the population of Andhra Pradesh in India,6 and the result is opposite in northern India.39 However, the study on the relationship between VDR gene rs3847987, rs739837 polymorphism and pulmonary tuberculosis has not been reported. Ganmaa et al conducted a cross-sectional study of 9810 children and found that serum vitamin D deficiency was a potential risk factor for tuberculosis,41 while Ruiz-Tagle et al found that hypovitaminosis D had little effect on the M. tuberculosis infection.42 Another report showed that active tuberculosis children owned lowed vitamin D and VDR mRNA expression levels and increased VDR DNA methylation than the healthy controls, so the VDR hypermethylation may be involved in the impairment in the VDR-mediated cytolytic and antimicrobial effector cell response in pediatric TB disease.43 Future studies can explore the roles of DNA methylation and its interaction with SNPs in VDR in adult tuberculosis.
The present study showed that the proportion of Beijing lineage was 50.8% (33/65), which was consistent with previous studies from Xinjiang, China.15–17,44 It has been reported that human pathogens have geographically structured population genetics and each of the six phylogeographical lineages (lineage 1 to 6) of M. tuberculosis were associated with representative, sympatric human populations.45,46 Lineage 1, 2, 3, and 4 of M. tuberculosis isolates were prevailing in China based on the database of the National Survey of Drug-Resistant Tuberculosis in 2007 and reported that Lineage 2 accounted for 75% of all strains.44 Lineage 2 (or East Asian lineage) which show high prevalence in East-Asian countries is majorly composed of Beijing family which attract attention by their hyper-virulence in laboratory models, their recent dissemination in human populations, and their association with drug resistance.47,48 Several studies have conducted genotyping analysis on M. tuberculosis isolates from Xinjiang, and the results show that the proportions of Beijing lineage isolates range from 42% to 60%,15–17,44 which was lower than the national average of 73.9% in China.46
During the analysis on association between polymorphisms of VDR gene and lineages of M. tuberculosis, we grouped tuberculosis patients according to information on the genealogy of the infecting pathogens and no significance associations were found. We also combined the haplotypes to help locate causative genes or regions with tuberculosis or M. tuberculosis infection more precisely. Haplotypes are linear arrangements of alleles with a tendency to be inherited as a whole. In the present study, we found that two out of six loci of the VDR gene formed one haplotype block, and the generated haplotypes were not observed to be associated with susceptibility to tuberculosis or the lineages of M. tuberculosis infected. Omae et al performed a M. tuberculosis lineage-based GWAS with CD53 gene and found that two SNPs (rs1418425 and rs1494320) are risk factors for the old age tuberculosis onset infected with strains of non-Beijing lineage, whilst no correlation were found in old age cases infected with Beijing lineage, they speculated that the genetic risk of host susceptibility is related to the lineage of infected strains.30 Müller et al evaluated two geographically distinct cohorts (South African population composed of 947 participants and the Ghanaian population composed of 3311 participants) and found that 32 SNPs were statistically significantly associated with risk for infection with different types of the M. tuberculosis complex in the Ghanaian cohort, whilst no correlation were found in South African cohort.26
There were several limitations in the present study, including that we enrolled healthy staffs who worked in hospitals for the control group instead of enrolling individuals in communities and M. tuberculosis isolates were only acquired from part of cases, improvements should be taken in the future studies. Second, there were still some factors without being consideration in our studies such as the expression levels of VDR, vitamin D levels of population and drug susceptibilities of isolates, which are essential to understand the association between VDR gene and susceptibility to tuberculosis. Third, the present study did not evaluate the probability of latent tuberculosis infectious disease with these SNPs progressing to tuberculosis. In the future studies, all of these factors should be improved or strengthened.
Conclusions
In conclusion, the present study showed no relation between VDR gene polymorphisms and tuberculosis susceptibility in the population from Xinjiang, China. Much evidence has shown that the evolution of M. tuberculosis in the host was affected by the immunity of the host, which provides hints of focusing on the immune-related genes to find genes for tuberculosis susceptibility. So, further researches are needed to clarify the associations between VDR and tuberculosis susceptibility.
Abbreviations
CTAB, Cetyltrimethylammonium bromide; EDTA, Ethylene diamine tetraacetic acid; GWAS, Genome-wide association studies; HIV, Human immunodeficiency virus; HLA, Human leukocyte antigen; HWE, Hardy–Weinberg equilibrium; LD, Linkage disequilibrium; PS, Propensity score; SMD, Standardized mean differences; SNPs, Single-nucleotide polymorphisms; VDR, Vitamin D receptor; WHO, World Health Organization.
Data Sharing Statement
The datasets used and analyzed during the current study are available from the corresponding author on reasonable request.
Ethics Approval and Consent to Participate
This study was in line with the Declaration of Helsinki and obtained approval (XJMU8HEC-20161215) from the Ethics Committee of The Eighth Affiliated Hospital of Xinjiang Medical University. All methods were performed in accordance with the relevant guidelines and regulations. Written informed consent was obtained from individual or guardian participants.
Acknowledgments
We appreciated the staff of Xinjiang Uygur Autonomous Region Chest Hospital, Kashgar, Kuqa and Wushi for supplying strains and collecting data.
Funding
This study was supported by the project (2017A03006) of the Major science and technology programs of Xinjiang Uygur Autonomous Region from department of Science and Technology, Xinjiang Uygur Autonomous Region and Mega Project of Research on the Prevention and Control of HIV/AIDS, Viral Hepatitis Infectious Diseases (2018ZX10103001-003-012) from the Ministry of Science and Technology, China. The funders had no role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Disclosure
We have no conflicts of interest to declare.
References
1. WHO. Global tuberculosis report 2022; 2022. Available from: https://www.who.int/publicationsdetail-redirect/9789240061729.
2. Abel L, Fellay J, Haas DW, et al. Genetics of human susceptibility to active and latent tuberculosis: present knowledge and future perspectives. Lancet Infect Dis. 2018;18(3):e64–e75. doi:10.1016/S1473-3099(17)30623-0
3. Abreu R, Giri P, Quinn F. Host-pathogen interaction as a novel target for host-directed therapies in tuberculosis. Front Immunol. 2020;11:1553. doi:10.3389/fimmu.2020.01553
4. Quintana-Murci L, Clark AG. Population genetic tools for dissecting innate immunity in humans. Nat Rev Immunol. 2013;13(4):280–293. doi:10.1038/nri3421
5. Silva CA, Fernandes DC, Braga ACO, et al. Investigation of genetic susceptibility to Mycobacterium tuberculosis (VDR and IL10 genes) in a population with a high level of substructure in the Brazilian Amazon region. Int J Infect Dis. 2020;98:447–453. doi:10.1016/j.ijid.2020.06.090
6. Medapati RV, Suvvari S, Godi S, et al. NRAMP1 and VDR gene polymorphisms in susceptibility to pulmonary tuberculosis among Andhra Pradesh population in India: a case-control study. BMC Pulm Med. 2017;17(1):89. doi:10.1186/s12890-017-0431-5
7. Thomas L, Sekhar Miraj S, Surulivelrajan M, et al. Influence of single nucleotide polymorphisms on rifampin pharmacokinetics in tuberculosis patients. Antibiotics. 2020;9(6):307. doi:10.3390/antibiotics9060307
8. Sha YX, Zhang X, Zhou HQ, et al. Study of vitamin D receptor gene polymorphisms and susceptibility to tuberculosis in adolescents. J Anhui Med Univ. 2020;55(10):1588–1592.
9. Meng XJ. A Study on the Association of Polymorphisms of the VDR Gene and NRAMP1 Gene with the Susceptibility to Tuberculosis of Xinjiang Uyghurs. Shihezi: Shihezi University; 2009.
10. Li CZ. A Study on the Association of Polymorphisms of the VDR Gene and NRAMP1 Gene with the susceptibility to Tuberculosis of Xinjiang Hazakhs. Shihezi: Shihezi University; 2009.
11. Wu JD. A Study on the Association of Polymorphisms of the VDR Gene and NRAMP1 Gene with the Susceptibility to Tuberculosis of Xinjiang Han. Shihezi: Shihezi University; 2009.
12. Xu X, Shen M. Associations between vitamin D receptor genetic variants and tuberculosis: a meta-analysis. Innate Immun. 2019;25(5):305–313. doi:10.1177/1753425919842643
13. Wang Y, Li HJ. A meta-analysis on associations between vitamin D receptor genetic variants and tuberculosis. Microb Pathog. 2019;130:59–64. doi:10.1016/j.micpath.2019.02.027
14. Pang Y, Zhou Y, Zhao B, et al. Spoligotyping and drug resistance analysis of Mycobacterium tuberculosis strains from national survey in China. PLoS One. 2012;7:e32976. doi:10.1371/journal.pone.0032976
15. Wan K, Liu J, Hauck Y, et al. Investigation on Mycobacterium tuberculosis diversity in China and the origin of the Beijing clade. PLoS One. 2011;6:e29190. doi:10.1371/journal.pone.0029190
16. Chen H, He L, Huang H, et al. Mycobacterium tuberculosis lineage distribution in Xinjiang and Gansu Provinces, China. Sci Rep. 2017;7:1068. doi:10.1038/s41598-017-00720-9
17. Yuan L, Mi L, Li Y, et al. Genotypic characteristics of Mycobacterium tuberculosis circulating in Xinjiang, China. Infect Dis. 2016;48:108–115. doi:10.3109/23744235.2015.1087649
18. National Health and Family Planning Commission of the People’s Republic of China, WS 288–2017. Diagnosis for Pulmonary Tuberculosis. Beijing: People’s Medical Publishing House; 2017.
19. National Health and Family Planning Commission of the People’s Republic of China, WS 196-2017. Classification of Tuberculosis. Beijing: People’s Medical Publishing House; 2017.
20. Honore S, Vincensini JP, Hocqueloux L, et al. Diagnostic value of a nested polymerase chain reaction assay on peripheral blood mononuclear cells from patients with pulmonary and extra-pulmonary tuberculosis. Int J Tuberc Lung Dis. 2001;5(8):754–762.
21. Warren RM, Victor TC, Streicher EM, et al. Patients with active tuberculosis often have different strains in the same sputum specimen. Am J Respir Crit Care Med. 2004;169(5):610–614. doi:10.1164/rccm.200305-714OC
22. Thakkinstian A, McElduff P, D’Este C, et al. A method for meta-analysis of molecular association studies. Stat Med. 2005;24(9):1291–1306. doi:10.1002/sim.2010
23. Barrett JC, Fry B, Maller J, et al. Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics. 2005;21(2):263–265. doi:10.1093/bioinformatics/bth457
24. Wang LX, Cheng SM, Chen MT, et al. The fifth national tuberculosis epidemiological survey in 2010. Chin J Antitubercul. 2012;34:485–508.
25. Uren C, Hoal EG, Möller M. Mycobacterium tuberculosis complex and human co-adaptation: a two-way street complicating host susceptibility to TB. Hum Mol Genet. 2021;30(R1):R146–R153. doi:10.1093/hmg/ddaa254
26. Müller SJ, Schurz H, Tromp G, et al. A multi-phenotype genome-wide association study of clades causing tuberculosis in a Ghanaian- and South African cohort. Genomics. 2021;113(4):1802–1815. doi:10.1016/j.ygeno.2021.04.024
27. McHenry ML, Bartlett J, Igo RP, et al. Interaction between host genes and Mycobacterium tuberculosis lineage can affect tuberculosis severity: evidence for coevolution? PLoS Genet. 2020;16:e1008728. doi:10.1371/journal.pgen.1008728
28. Caws M, Thwaites G, Dunstan S, et al. The influence of host and bacterial genotype on the development of disseminated disease with Mycobacterium tuberculosis. PLoS Pathog. 2008;4:e1000034. doi:10.1371/journal.ppat.1000034
29. van Crevel R, Parwati I, Sahiratmadja E, et al. Infection with Mycobacterium tuberculosis Beijing genotype strains is associated with polymorphisms in SLC11A1/NRAMP1 in Indonesian patients with tuberculosis. J Infect Dis. 2009;200(11):1671–1674. doi:10.1086/648477
30. Omae Y, Toyo-Oka L, Yanai H, et al. Pathogen lineage-based genome-wide association study identified CD53 as susceptible locus in tuberculosis. J Hum Genet. 2017;62(12):1015–1022. doi:10.1038/jhg.2017.82
31. Thye T, Niemann S, Walter K, et al. Variant G57E of mannose binding lectin associated with protection against tuberculosis caused by Mycobacterium africanum but not by M. tuberculosis. PLoS One. 2011;6(6):e20908. doi:10.1371/journal.pone.0020908
32. Songane M, Kleinnijenhuis J, Alisjahbana B, et al. Polymorphisms in autophagy genes and susceptibility to tuberculosis. PLoS One. 2012;7(8):e41618. doi:10.1371/journal.pone.0041618
33. Comstock GW. Tuberculosis in twins: a re-analysis of the Prophit survey. Am Rev Respir Dis. 1978;117(4):621–624. doi:10.1164/arrd.1978.117.4.621
34. Sadykov M, Azizan A, Kozhamkulov U, et al. Association of genetic variations in the vitamin D pathway with susceptibility to tuberculosis in Kazakhstan. Mol Biol Rep. 2020;47(3):1659–1666. doi:10.1007/s11033-020-05255-3
35. Wu F, Zhang W, Zhang L, et al. NRAMP1, VDR, HLA-DRB1, and HLA-DQB1 gene polymorphisms in susceptibility to tuberculosis among the Chinese Kazakh population: a case-control study. Biomed Res Int. 2013;2013:484535. doi:10.1155/2013/484535
36. Rook GA, Steele J, Fraher L, et al. Vitamin D3, gamma interferon, and control of proliferation of Mycobacterium tuberculosis by human monocytes. Immunology. 1986;57(1):159–163.
37. Sutaria N, Liu CT, Chen TC. Vitamin D status, receptor gene polymorphisms, and supplementation on tuberculosis: a systematic review of case-control studies and randomized controlled trials. J Clin Transl Endocrinol. 2014;1(4):151–160. doi:10.1016/j.jcte.2014.08.001
38. Selvaraj P, Harishankar M, Afsal K. Vitamin D: immuno-modulation and tuberculosis treatment. Can J Physiol Pharmacol. 2015;93(5):377–384. doi:10.1139/cjpp-2014-0386
39. Panwar A, Garg RK, Malhotra HS, et al. 25-hydroxy vitamin D, vitamin D receptor and toll-like receptor 2 polymorphisms in spinal tuberculosis: a case-control study. Medicine. 2016;95(17):e3418. doi:10.1097/MD.0000000000003418
40. Sharma PR, Singh S, Jena M, et al. Coding and non-coding polymorphisms in VDR gene and susceptibility to pulmonary tuberculosis in tribes, castes and Muslims of Central India. Infect Genet Evol. 2011;11(6):1456–1461. doi:10.1016/j.meegid.2011.05.019
41. Ganmaa D, Khudyakov P, Buyanjargal U, et al. Prevalence and determinants of QuantiFERON-diagnosed tuberculosis infection in 9810 Mongolian schoolchildren. Clin Infect Dis. 2019;69(5):813–819. doi:10.1093/cid/ciy975
42. Ruiz-Tagle C, Romero F, Naves R, et al. Vitamin D and cathelicidin levels and susceptibility to Mycobacterium tuberculosis infection acquisition in household contacts. Enferm Infecc Microbiol Clin. 2023:S2529-993X(23)00013–8. doi:10.1016/j.eimce.2022.04.013
43. Maruthai K, Sankar S, Subramanian M. Methylation status of VDR gene and its association with vitamin D status and VDR gene expression in pediatric tuberculosis disease. Immunol Invest. 2022;51(1):73–87. doi:10.1080/08820139.2020.1810702
44. Chen H, He L, Cai C, et al. Characteristics of distribution of Mycobacterium tuberculosis lineages in China. Sci China Life Sci. 2018;61(6):651–659. doi:10.1007/s11427-017-9243-0
45. Comas I, Coscolla M, Luo T, et al. Out-of-Africa migration and Neolithic coexpansion of Mycobacterium tuberculosis with modern humans. Nat Genet. 2013;45(10):1176–1182. doi:10.1038/ng.2744
46. Gagneux S, DeRiemer K, Van T, et al. Variable host-pathogen compatibility in Mycobacterium tuberculosis. Proc Natl Acad Sci U S A. 2006;103(8):2869–2873. doi:10.1073/pnas.0511240103
47. Glynn JR, Whiteley J, Bifani PJ, et al. Worldwide occurrence of Beijing/W strains of Mycobacterium tuberculosis: a systematic review. Emerg Infect Dis. 2002;8(8):843–849. doi:10.3201/eid0805.020002
48. Karmakar M, Trauer JM, Ascher DB, et al. Hyper transmission of Beijing lineage Mycobacterium tuberculosis: systematic review and meta-analysis. J Infect. 2019;79(6):572–581. doi:10.1016/j.jinf.2019.09.016
© 2023 The Author(s). This work is published and licensed by Dove Medical Press Limited. The
full terms of this license are available at https://www.dovepress.com/terms
and incorporate the Creative Commons Attribution
- Non Commercial (unported, 3.0) License.
By accessing the work you hereby accept the Terms. Non-commercial uses of the work are permitted
without any further permission from Dove Medical Press Limited, provided the work is properly
attributed. For permission for commercial use of this work, please see paragraphs 4.2 and 5 of our Terms.
