Back to Journals » Infection and Drug Resistance » Volume 12
Development of a multiple cross displacement amplification combined with nanoparticles-based biosensor assay to detect Neisseria meningitidis
Authors Li S, Liu C, Liu Y, Ma Q, Wang Y, Wang Y
Received 1 April 2019
Accepted for publication 17 June 2019
Published 15 July 2019 Volume 2019:12 Pages 2077—2087
DOI https://doi.org/10.2147/IDR.S210735
Checked for plagiarism Yes
Review by Single anonymous peer review
Peer reviewer comments 2
Editor who approved publication: Professor Suresh Antony
Shijun Li,*,1 Chunting Liu,*,1 Ying Liu,1 Qing Ma,1 Yue Wang,1 Yi Wang2,3
1Laboratory of Bacterial Infectious Disease of Experimental Center, Guizhou Provincial Center for Disease Control and Prevention, Guiyang, Guizhou, 550004, People’s Republic of China; 2Key Laboratory of Major Diseases in Children, Beijing Pediatric Research Institute, Beijing Children’s Hospital, Capital Medical University, National Center for Children’s Health, Beijing, 10045, People’s Republic of China; 3Ministry of Education, National Key Discipline of Pediatrics (Capital Medial University), Beijing Pediatric Research Institute, Beijing Children’s Hospital, Capital Medical University, National Center for Children’s Health, Beijing, 10045, People’s Republic of China
*These authors contributed equally to this work
Background: Neisseria meningitidis is a leading pathogen of meningococcal disease in humans worldwide. Multiple cross displacement mplification (MCDA) combined with nanoparticles-based lateral flow biosensor (MCDA-LFB) has been reported for the rapid detection of several bacterial pathogens in recent years. Here, therefore we developed an MCDA-LFB assay for the rapid detection of N. meningitis.
Methods: A set of 10 primers specifically to recognize 10 different regions of the ctrA gene of N. meningitidis were designed. MCDA was developed and combined with a LFB to detect the ctrA gene of N. meningitidis. The reaction time and temperature condition for the MCDA-LFB were optimized and then the MCDA-LFB was applied to detect the DNA from clinical samples.
Results: MCDA-LFB assay was successfully established for the detection of N. meningitidis based on the ctrA gene. The MCDA assay was optimized at 64°C for only 35 mins and the products of amplification were directly sensed by LFB. The whole operation, including DNA template preparation (∼20 mins), MCDA reaction (35 mins) and results interpretation (∼2 mins) could be finished in no more than 60 mins. The detection limit was as low as 10 fg/reaction (around 3 CFUs/reaction) of pure N. meningitidis DNA, with no cross-reaction with other bacterial DNA.
Conclusion: The MCDA-LFB techniques developed in the present study are an effective tool for the rapid detection of N. meningitidis, especially in resource-poor countries in meningococcal disease epidemic period.
Keywords: Neisseria meningitidis, multiple cross displacement amplification, lateral flow biosensor, MCDA-LFB, limit of detection
Introduction
Meningococcal disease has been reported for more than 200 years, which recognized as a worldwide public health problem due to its global distribution, high-mortality rates and significant morbidity.1 Furthermore, meningococcal disease is associated with high-financial costs both in patient treatment and rehabilitation.1–3 Acute meningitis is, globally, a major threat to the health of infants, children, and adults.4 Neisseria meningitidis is a leading causative agent of bacterial meningitis in humans,5 which leads to around 1.2 million cases and 135,000 deaths every year.6,7 N. meningitidis, a Gram-negative β-proteobacterium, belongs to the member of the bacterial family Neisseriaceae.8,9 A total of 12 different N. meningitidis serogroups, including A, B, C, E, H, I, K, L, W, X, Y and Z, have been identified to date based on antigenic differences in the capsular polysaccharide.10,11 The distribution of epidemic serogroup of N. meningitidis may vary geographically,8 but serogroups A, B, C, W, X, and Y are responsible for the majority of the disease.9,10,12 For example, serogroup B is the dominant serogroup of N. meningitidis as the major cause of meningococcal disease in Thailand and Taiwan,13 and serogroups A, C, X, and Y have been identified in these and other Asian countries,9,13,14 while serogroups B and C are major causes of invasive meningococcal disease in Europe and other industrialized countries.13 In the Americas, the majority of meningococcal disease is caused by serogroups B and C,9 with the emergence of serogroups W and Y in some countries.15 The incidence of meningococcal meningitis in sub-Saharan Africa greatly exceeds other regions in the world,16,17 and the predominant serotype associated with outbreaks in the meningitis belt has been serogroup A from 1990 to 2010,16,17 with the emergence of serogroups W and X in some countries in recent years.18,19
Invasive disease caused by N. meningitidis is traditionally diagnosed using bacterial culture, followed with identification by using Gram staining, immunochromatographic antigen detection.8,20,21 However, the diagnosis is complicated and requires well-equipped laboratory with appropriate biosafety equipment and procedures.22 Another disadvantage of these assays is the relatively low-diagnostic sensitivity.23 Overuse of antibiotics reduces the utility of culture-based methods due to an inhibition of bacterial growth.24 Several PCR-based methods have been developed for the identification of the N. meningitidis based on the polysialyltransferase siaD gene or other genes including crgA, 16S rRNA and porA.25 Additionally, real-time and multiplex PCR assays for identification of N. meningitidis have also been reported.5,26,27 However, these methods are expensive due to the requirement of specific equipment and they are complicated to perform in resource-poor laboratories in many developing countries.8
Apart from the PCR-based methods, the isothermal amplification technique, termed as loop-mediated isothermal amplification (LAMP), has also been developed to detect N. meningitidis.4,8,28 LAMP assay offers an alternative to bacterial cultivation and PCR due to its greater specificity and sensitivity than that of conventional PCR and it requires simpler equipment or machines. Although LAMP assays displayed high-amplification efficiency comparable to that of the conventional PCR method, the marginal amounts of nucleic acid sequences were still difficult to analyze in various samples.29,30 In particular, the results of N. meningitidis-LAMP techniques were determined using color indicator (such as SYBR green I and calcein dyes), agarose gel electrophoresis and real-time turbidity equipment. The analysis of N. meningitidis-LAMP amplifications by color with the naked eyes is potentially subjective, and it is possibility that a clinical sample may be somewhat ambiguous to the unaided eye when the concentration of N. meningitidis templates is low. The use of gel electrophoresis to analyze products is a complex process and increases the risk of degradation and carryover contamination. The real-time turbidity detection of N. meningitidis-LAMP results requires an additional optical instrument and easily suffers from background interference.
More recently, multiple cross displacement amplification (MCDA) was developed to overcome the technical barriers posed by current isothermal amplification strategies. MCDA assay was conducted under isothermal conditions, and simple heater or water bath that maintained a uniform temperature was sufficient and the amplicons can be sensed by disposable lateral flow biosensors (LFBs).31 It is likely the preferred method as reading the results is less subjective and does not require instrumentation. MCDA has been applied for the rapid detection of serious bacterial pathogens such as Listeria monocytogenes, Vibrio parahaemolyticus, Vibrio cholerae and Klebsiellapneumoniae in the recent years.30–34
The ctrA gene, encoding an outer membrane protein involved in capsule transport, has been depicted specific for the identification of N. meningitidis.25 In the current study, an MCDA-LFB assay, based on the ctrA gene, was developed to provide a simple, rapid, highly specific and sensitive method for N. meningitidis screening. The analytical sensitivity, specificity and availability were successfully evaluated using pure cultures and clinical samples.
Materials and methods
Reagents and instruments
Both visual detection reagent (malachite green, MG) and Isothermal Amplification Kits were obtained from BeiJing-HaiTaiZhengYuan Technology Co., Ltd. (Beijing, China). A DNA Extraction Kit was obtained from SBS Genetech Co., Ltd. (Beijing, China). Biotin-BSA (biotinylated BSA) and anti-fluorescein isothiocyanate (FITC) Ab (rabbit anti-fluorescein antibody) were purchased from the Abcam Co., Ltd. (Shanghai, China). Sample pads, membrane backing materials, nitrocellulose (NC) membranes, conjugate pads and absorbent pads were purchased from the Jie Yi Biotechnology Co., Ltd. (Shanghai, China). Streptavidin-immobilized 40-nm gold nanoparticles (SA-Gs) were obtained from BeiJing-HaiTaiZhengYuan Technology Co., Ltd.
Preparation of a gold nanoparticle-based dipstick biosensor
A LFB (4 mm × 60 mm) was prepared based on previous reports with some modifications.35,36 Briefly, the sample pad, conjugate pad, NC membrane and absorbent pad were laminated onto a plastic adhesive backing card. In order to form the test line (TL) and control line (CL), the anti-FITC Ab (0.2 mg/mL) and biotin-BSA (2.5 mg/mL) were sprayed onto the NC membrane. The TL and CL were separated by 5 mm. SA-Gs diluted in 0.01 M PBS (pH 7.4) were deposited on the conjugate pad of the strip. The assembled cards were cut into 4-mm wide strips (Deli No. 8012) and packaged in a plastic box with desiccant gel and kept at room temperature.
Bacterial strains and DNA template preparation
The N. meningitidis reference strains for serogroups A, B, C, D,W-135, 29-E, X, Y, Z and C were obtained from ATCC (Table 1). The N. meningitidis isolates and non-N. meningitidis strains used for specific validation were isolated in Guizhou Province and stored in Laboratory of Guizhou Provincial Center for Disease Control and Prevention (GZCDC) (Table 1). The N. meningitidis strains were cultured on chocolate agar culture plate (Shanghai Laibo Bio-chemical Co. Ltd, Shanghai, China) and harvested as described previously.8 The bacterial cultures were collected in 1 mL PBS and the CFUs were determined by serial dilutions of culture suspensions inoculated on chocolate agar plate.8 DNA was extracted from cultures of isolated strains using the DNA Extraction Kit (SBS Genetech Co., Ltd.) according to the manufacturer’s directions, followed with quantification using a NanoDrop ND-1000 instrument (Calibre, Beijing, China). Genomic DNA of N. meningitidis strain 13007 was serially diluted (1 ng/μL, 100 pg/μL, 10 pg/μL, 1 pg/μL, 100 fg/μL, 10 fg/μL and 1 fg/μL) for sensitivity analysis of N. meningitidis-MCDA-LFB detection. Other bacterial strains (non-N. meningitidis strain) were stored in 10% (w/v) glycerol broth at −70°C and all samples were extracted from all culture strains using the QIAamp DNA Mini Kit (Qiagen, Germantown, MD, USA).
|
Table 1 Bacterial strains used in this study |
MCDA assay primers design and synthesis
The MCDA primers set, including F1, F2, CP1, CP2, C1, C1*, C2, D1, D1*, D2, R1 and R2, was designed using primer software PREMIER 5.0 (Canada). Hairpin structures and hybrids were analyzed using the Integrated DNA Technologies design tools. Blast analysis was applied to verify the specificity of the MCDA primers for N. meningitidis. The 5′ ends of C1 and D1 primers were labeled with biotin and FITC, respectively. The details of primers are displayed in Figure 1 and Table 2, which were synthesized and purified by Tianyi-Huiyuan Biotech Co., Ltd. (Beijing, China) at HPLC purification grade.
|
Table 2 The primers used in this study |
The standard MCDA assay
MCDA reactions were carried out in 25-μL reaction system as described in previous reports.33,34 Briefly, each reaction contained 0.4 μM each of displacement primers F1 and F2, 0.8 μM each of amplification primers C1*, C2, R1, R2, D1* and D2, 1.6 μM each of cross primers CP1 and CP2, 12.5 μL of 2× reaction mix (Isothermal Amplification® kit), 1 μL of Bst DNA polymerase (8 U) and 1 μL of DNA template. Three detection methods, including colorimetric indicator (MG), real-time turbidimeter (LA-320C) and LFB, were applied to monitor the MCDA amplification products.
The amplified products should cause a color change from colorless to light green when using the MG method, with no changes in color for negative controls and blank control. Applying the LFB, both the CL and TL should be visible in positive reactions, and only the CL was observed in negative and blank controls. The optimal temperature of reaction was determined in the range of 60–67°C for 60 mins. Mixtures with 1 μL of genomic DNA of Staphylococcus aureus (S. aureus, GZCDC isolate) and Streptococcus pneumoniae (S. pneumoniae, GZCDC isolate) strains were used as negative controls, and mixtures with 1 μL of double-distilled water (DW) were chosen as blank controls.
Sensitivity and specificity of the N. meningitidis-MCDA-LFB assay
The genomic templates were applied to determine the MCDA limit of detection (LoD) by using serial dilutions as described above. Performances of N. meningitidis-MCDA-LFB, colorimetric indicator (MG) and turbidity analysis were analytically compared. Three replicates of each dilution were examined. The specificity of N. meningitidis-MCDA-LFB was analyzed using DNA templates from other 44 bacterial strains (Table 1). The examinations were repeated at least two times.
Optimization of the amplification time of the N. meningitidis-MCDA-LFB assay
The MCDA mixture was incubated at the optimal temperature for different lengths of time (15, 25, 35 and 45 mins). The amplification products were detected using an LFB, and two replicates of each amplification time were tested.
Application of N. meningitidis-MCDA-LFB detection in clinical samples
N. meningitidis-MCDA-LFB was used to detect N. meningitidis DNA from the total DNA of clinical samples. Fifty-six samples, including 2 cerebrospinal fluids samples, 5 blood samples and 39 nasal swab samples, were collected from patients distributed in prefecture Guiyang, Anshun, Zunyi, Tongren, Qiannan, Qiandongnan Qianxinan and Bijie of Guizhou Province. All the clinical samples used in this study were not specifically isolated for this research. They were part of the routine CDC (Center for Disease Control and Prevention) laboratory procedure in China. The National Health and Family Planning Commission of China determined that the collection of data from human cases of infectious disease was part of continuing public health surveillance of a notifiable infectious disease and was exempt from institutional review board assessment. All data were supplied and analyzed in an anonymous format, without access to personal identifying information. The clinical samples have been detected by using traditional cultivation and isolation methods. Simultaneously, traditional PCR targeting crgA gene recommended by the Diagnosis Standard for Meningococcal meningitis of China (WS 295—2019) was applied for the detection of the above clinic samples. Briefly, each 20 μL reaction system contained approximately 2 μL of DNA, 10 μL of 2x Taq PCR Mix (TaKaRa, Otsu, Japan), 1 μL of forward primer (GCTGGCGCCGCTGGCAACAAAATTC) and reverse primer (TTCTGCAGATTGCGGCGTGCCGT) and 7 μL of deionized water. Amplification was performed as per the following conditions: 94°C for 5 mins, followed by 30 cycles of 92°C for 30 s, 55°C for 40 s, and 72°C for 30 s, with a final single extension of 72°C for 2 mins, and then held at 4°C. Amplified products were characterized by electrophoresis of 1 μL of each reaction on a 1.2% agarose gel for 30 mins at 85 V. The specificity and sensitivity of N. meningitidis-MCDA-LFB, traditional PCR and the conventional cultivation methods detection of N. meningitidis were compared.
Results
Confirmation and detection of N. meningitidis MCDA products
In order to confirm the effectiveness of primers for N. meningitidis-MCDA detection (Table 2), the DNA for pure cultures of N. meningitidis was detected using MCDA at 64°C for 1 hr. DNA from N. meningitidis strain 13007 was effectively amplified, but no amplification was observed with DNA from S. aureus (GZCDC isolate) and S. pneumoniae (GZCDC isolate) and the blank control (DW) (Figure 2). Therefore, the N. meningitidis-MCDA primer set was chosen to develop the MCDA-LFB assay for N. meningitidis detection.
Optimum temperature determined for the N. meningitidis-MCDA-LFB
To verify the optimum amplification temperature, N. meningitidis strain 13007 was used as the positive control at a level of 10 pg per reaction and the reactions were monitored by the real-time turbidity method. All tested temperatures (60–67°C with 1°C increments) generated typical kinetics graphs, with faster amplification achieved at assay temperatures of 64°C (Figure 3). Thus, the amplification temperature of 64°C was applied to perform the remaining experiments performed in the current report.
Sensitivity of MCDA-LFB for N. meningitidis detection
Serial dilutions of N. meningitidis genomic DNA were used to examine the LoD of the MCDA-LFB assay. Our results demonstrated that the analytical sensitivity of the N. meningitidis-MCDA-LFB assay was 10 fg per reaction (around 3 CFU per reaction) (Figure 4A). Furthermore, the analytical sensitivity of the MCDA assay was examined by real-time turbidity detection and colorimetric monitoring of amplification products with MG reagents (Figure 4B and C). By MG reagents and real-time turbidity, the LoD of the MCDA assay was also 10 fg per reaction, which was completely consistent with LFB detection.
Optimized the reaction time for N. meningitidis-MCDA-LFB assay
To evaluate the optimum time required for the N. meningitidis-MCDA-LFB assay during reaction stage, a total of four reaction times (15, 25, 35 and 45 mins) were compared at 64°C according to the standard MCDA conditions. The lowest DNA level (10 fg of N. meningitidis templates per reaction) displayed two visible-red lines (TL and CL) when the amplification only proceeded for 35 mins at 64°C (Figure 5). So, the reaction time of 35 mins was recommended as an optimal reaction time for N. meningitidis-MCDA-LFB assay.
Specificity of MCDA-LFB for N. meningitidis detection
When DNA from the bacteria listed in Table 1 was used in the MCDA-LFB assay, only the DNA from the N. meningitidis strains provided positive results. DNA from nonpathogenic N. meningitidis strains and from all non-N. meningitidis isolates did not generate detectable amplification products (Figure 6). Two red lines, including the TL and CL, appeared on the strips for the positive tests, and only one red line (the CL) appeared on the biosensors, suggesting negative results for non-N. meningitidis bacterial isolates and the blank control.
Application of MCDA-LFB for detection of N. meningitidis in clinical samples
A total of 56 samples were used for the application of N. meningitidis-MCDA-LFB developed in the present study. Among the 56 samples, 16 samples had been confirmed as N. meningitidis positive using the traditional PCR method, and the other 40 samples were negative. The results of MCDA-LFB detection showed 19 samples were positive, which covered all the 16 positive samples using traditional PCR. Consistent detection results were observed when using MCDA-LFB and traditional cultivation and isolation methods, both of the two methods confirmed 19/56 positive samples (Table 3).
|
Table 3 Comparison of conventional PCR, culture-biotechnical and MCDA-LFB for the detection of N. meningitidis in clinical samples |
Discussion
In the present study, MCDA-LFB assay was established for the detection of N. meningitidis targeting on the ctrA gene with excellent specificity and sensitivity. The assay was optimized at 64°C for only 35 mins, and the products were directly sensed by LFB. The whole operation could be finished within 60 mins. The LoD was 10 fg/reaction of pure N. meningitidis DNA. The protocol was convenient, simple and does not require costly specialized equipment. Therefore, the MCDA-LFB assay presented in this study will offer an effective strategy for the rapid detection of N. meningitidis, which is of potential application value in the field and resource-deficient situations.
The high specificity of this method is likely due to using the ctrA as target gene, encoding an outer membrane protein involved in capsule transport, which has been depicted specific for the identification of N. meningitidis.25 Besides, the 10 primer sequences designed based on different regions of the target gene sequence also enhanced the specificity of MCDA technique, which has been proven in previous studies.29,37 The specificity of the assay was successfully verified using pure cultures. The test was positive for all N. meningitidis isolates but negative for other non-N. meningitidis strains (Figure 6). Apart from the excellent specificity, the N. meningitidis-MCDA-LFB method developed in the present study showed sufficient sensitivity in the detection of N. meningitidis. The LoD was 10 fg DNA per reaction (about 3 CFU/reaction) extracted from N. meningitidis pure cultures (Figure 4). Although the traditional detection methods, including bacterial isolation and Gram staining, immunochromatographic antigen detection testing for N. meningitidis, are the most common methods for the N. meningitis detection,8,20,21 the shortage of sensitivity for these assays has also been previously described.23 The more recent PCR and LAMP techniques have been developed, but the marginal amounts of nucleic acid sequences were still hard to be detected in various samples.29,30 The application of the newly established MCDA-LFB in the detection of N. meningitidis in clinical samples showed higher positive rates than traditional PCR (Table 3). Although the positive results were equal to that of traditional cultivation and isolation methods, MCDA-LFB is likely the preferred technique as the result reading is less subjective and needs only minimal instrumentation. Therefore, the newly developed MCDA-LFB is able to make up for the shortages of these methods. Rapid identification of target pathogens was valuable for the accurate clinical diagnosis and choosing rational therapy for the patients. For example, the detection results are helpful for the selection of therapeutic drug for killing specific bacteria or other pathogens. The MCDA-LFB established in the current study offers a rapid tool to detect the DNA of N. meningitidis, which can be finished in 65 mins. Therefore, the MCDA-LFB developed in this report is a time-saving and convenient molecular technique for N. meningitidis detection compared with the traditional bacterial isolation and conventional PCR or LAMP methods. Compared to PCR-based methods, MCDA-LFB assay can be finished without the thermal denature and temperature changes during the reaction, avoiding the requirement of complicated and precise equipment. Moreover, it only needs a simple incubation at 63°C, and thus facilitates its application in resource-poor laboratories.37 MCDA can be performed using commercial kit for isothermal amplification kits such as NEB Warmstart kits and Isothermal Amplification kits. The cost for an MCDA reaction is around US$3.5, and the cost of the LFB per test costs about US$2, which is cheaper than PCR methods. In addition, labor costs are decreased because the operation of MCDA-LFB does not require certified technical personnel in a laboratory. However, although MCDA-LFB targeting ctrA gene of N. meningitides has strength for the rapid detection with advantages in specificity, sensitivity, time-saving, detection cost and so on, it also possesses limitation when compared with methods which can be used for N. meningitides serogroup identification and antimicrobial resistance detection.
In conclusion, we successfully developed an MCDA-LFB assay for the detection of N. meningitidis based on the ctrA gene. This method displayed high degree of specificity for the detection of N. meningitidis, with sensitivity of 10 fg per reaction with pure culture (around 3 CFUs/reaction). The whole process of detection can be completed in 65 mins and the protocol was convenient, simple and does not require costly specialized equipment. Moreover, the detection cost of this method is cheaper than other methods such as PCR. Thus, the MCDA-LFB assay presented in this study will offer an effective strategy for the rapid detection of N. meningitidis, which is especially of potential application value in the field and resource-deficient situations.
Conclusion
The MCDA-LFB techniques developed in the present study are an effective tool for the rapid detection of N. meningitidis, especially in resource-poor countries in meningococcal disease epidemic period.
Acknowledgments
The work of this study was supported by the Special Funds of Program of Scientific and Technological Innovation Team of Guizhou Province (Qian Ke He Platform talent [2018]5606), Special Funds for High-Level Creative Talents Cultivation in Guizhou Province (Qian Ke He (2016)4021), and Special Funds for the Cultivation of Outstanding Youth Talents of Science and Technology in Guizhou Province (Qian Ke He Ren Word [2015] 09).
Disclosure
The authors report no conflicts of interest in this work.
References
1. Batista RS, Gomes AP, Dutra Gazineo JL, et al. Meningococcal disease, a clinical and epidemiological review. Asian Pac J Trop Med. 2017;10(11):1019–1029. doi:10.1016/j.vaccine.2016.02.014
2. Benard S, Wright C, Voisine J, Olivier CW, Gaudelus J. Lifetime cost of meningococcal disease in France: scenarios of severe meningitis and septicemia with purpura fulminans. J Infect Public Health. 2016;9(3):339–347. doi:10.1016/j.jiph.2015.10.016
3. Christensen H, Hickman M, Edmunds WJ, Trotter CL. Introducing vaccination against serogroup B meningococcal disease: an economic and mathematical modelling study of potential impact. Vaccine. 2013;31(23):2638–2646. doi:10.1016/j.vaccine.2013.03.034
4. Lee D, Kim EJ, Kilgore PE, et al. Clinical evaluation of a loop-mediated isothermal amplification (LAMP) assay for rapid detection of Neisseria meningitidis in cerebrospinal fluid. PLoS One. 2015;10(4):e0122922.
5. Zhu H, Wang Q, Wen L, et al. Development of a multiplex PCR assay for detection and genogrouping of Neisseria meningitidis. J Clin Microbiol. 2012;50(1):46–51.
6. van Deuren M, Meis JF. Meningococcal disease. N Engl J Med. 2001;345(9):699.
7. Baethgen LF, Weidlich L, Moraes C, et al. Epidemiology of meningococcal disease in southern Brazil from 1995 to 2003, and molecular characterization of Neisseria meningitidis using multilocus sequence typing. Trop Med Int Health. 2008;13(1):31–40.
8. Lee D, Kim EJ, Kilgore PE, et al. A novel loop-mediated isothermal amplification assay for serogroup identification of Neisseria meningitidis in cerebrospinal fluid. Front Microbiol. 2015;6:1548.
9. Stephens DS, Greenwood B, Brandtzaeg P. Epidemic meningitis, meningococcaemia, and Neisseria meningitidis. Lancet. 2007;369(9580):2196–2210.
10. Stephens DS. Biology and pathogenesis of the evolutionarily successful, obligate human bacterium Neisseria meningitidis. Vaccine. 2009;27(Suppl 2):B71–B77. doi:10.1016/j.vaccine.2009.04.070
11. Harrison OB, Claus H, Jiang Y, et al. Description and nomenclature of Neisseria meningitidis capsule locus. Emerg Infect Dis. 2013;19(4):566–573. doi:10.3201/eid1904.111799
12. Boisier P, Nicolas P, Djibo S, et al. Meningococcal meningitis: unprecedented incidence of serogroup X-related cases in 2006 in Niger. Clin Infect Dis. 2007;44(5):657–663. doi:10.1086/511646
13. Harrison LH, Trotter CL, Ramsay ME. Global epidemiology of meningococcal disease. Vaccine. 2009;27(Suppl 2):B51–B63. doi:10.1016/j.vaccine.2009.04.063
14. Kim SA, Kim DW, Dong BQ, Kim JS, Anh DD, Kilgore PE. An expanded age range for meningococcal meningitis: molecular diagnostic evidence from population-based surveillance in Asia. BMC Infect Dis. 2012;12:310. doi:10.1186/1471-2334-12-166
15. Chiavetta L, Chavez E, Ruzic A, Mollerach M, Regueira M. [Surveillance of Neisseria meningitidis in Argentina, 1993–2005: distribution of serogroups, serotypes and serosubtypes isolated from invasive disease]. Rev Argent Microbiol. 2007;39(1):21–27.
16. ffgk Enhanced surveillance of epidemic meningococcal meningitis in Africa: a three-year experience. Releve Epidemiologique Hebd. 2005;80(37):313–320.
17. Mustapha MM, Marsh JW, Harrison LH. Global epidemiology of capsular group W meningococcal disease (1970–2015): multifocal emergence and persistence of hypervirulent sequence type (ST)-11 clonal complex. Vaccine. 2016;34(13):1515–1523. doi:10.1016/j.vaccine.2016.02.014
18. MacNeil JR, Medah I, Koussoube D, et al. Neisseria meningitidis serogroup W, Burkina Faso, 2012. Emerg Infect Dis. 2014;20(3):394–399. doi:10.3201/eid2003.131407
19. Xie O, Pollard AJ, Mueller JE, Norheim G. Emergence of serogroup X meningococcal disease in Africa: need for a vaccine. Vaccine. 2013;31(27):2852–2861. doi:10.1016/j.vaccine.2013.04.036
20. Corless CE, Guiver M, Borrow R, Edwards-Jones V, Fox AJ, Kaczmarski EB. Simultaneous detection of Neisseria meningitidis, Haemophilus influenzae, and Streptococcus pneumoniae in suspected cases of meningitis and septicemia using real-time PCR. J Clin Microbiol. 2001;39(4):1553–1558. doi:10.1128/JCM.39.4.1553-1558.2001
21. Chanteau S, Dartevelle S, Mahamane AE, Djibo S, Boisier P, Nato F. New rapid diagnostic tests for Neisseria meningitidis serogroups A, W135, C, and Y. PLoS Med. 2006;3(9):e337. doi:10.1371/journal.pmed.0030337
22. Borrow R, Findlow J, Gray S, Taylor S, Kaczmarski E. Safe laboratory handling of Neisseria meningitidis. J Infect. 2014;68(4):305–312. doi:10.1016/j.jinf.2014.01.003
23. Campbell H, Borrow R, Salisbury D, Miller E. Meningococcal C conjugate vaccine: the experience in England and Wales. Vaccine. 2009;27(Suppl 2):B20–B29. doi:10.1016/j.vaccine.2009.04.067
24. Laxminarayan R, Duse A, Wattal C, et al. Antibiotic resistance-the need for global solutions. Lancet Infect Dis. 2013;13(12):1057–1098. doi:10.1016/S1473-3099(13)70318-9
25. Taha MK, Alonso JM, Cafferkey M, et al. Interlaboratory comparison of PCR-based identification and genogrouping of Neisseria meningitidis. J Clin Microbiol. 2005;43(1):144–149. doi:10.1128/JCM.43.1.144-149.2005
26. Fraisier C, Stor R, Tenebray B, Sanson Y, Nicolas P. Use of a new single multiplex PCR-based assay for direct simultaneous characterization of six Neisseria meningitidis serogroups. J Clin Microbiol. 2009;47(8):2662–2666. doi:10.1128/JCM.02415-08
27. Doyle CJ, Jennison AV. Corrigendum to “Novel real-time polymerase chain reactions for serogroup specific gene detection of Neisseria meningitidis serogroups B, C, W-135 and Y” [J. Microbiol. Meth. 94 (2)(2013) 83–85]. J Microbiol Methods. 2016;130:198. doi:10.1016/j.mimet.2016.09.004
28. McKenna JP, Fairley DJ, Shields MD, et al. Development and clinical validation of a loop-mediated isothermal amplification method for the rapid detection of Neisseria meningitidis. Diagn Microbiol Infect Dis. 2011;69(2):137–144. doi:10.1016/j.diagmicrobio.2010.10.008
29. Wang Y, Zhang L, Liu D, et al. Multiplex, rapid, and sensitive isothermal detection of nucleic-acid sequence by endonuclease restriction-mediated real-time multiple cross displacement amplification. Front Microbiol. 2016;7:753.
30. Wang Y, Li H, Luo L, Xu J, Ye C. Development of multiple cross displacement amplification label-based gold nanoparticles lateral flow biosensor for detection of Listeria monocytogenes. Int J Nanomedicine. 2017;12:473–486. doi:10.2147/IJN.S123625
31. Wang Y, Li H, Li D, Li K, Xu J, Ye C. Multiple cross displacement amplification combined with gold nanoparticle-based lateral flow biosensor for detection of Vibrio parahaemolyticus. Front Microbiol. 2016;7:2047.
32. Wang Y, Li H, Zhang L, Zhang J, Xu J, Ye C. Nanoparticle-based lateral flow biosensor combined with multiple cross displacement amplification for rapid, visual and sensitive detection of Vibrio cholerae. FEMS Microbiol Lett. 2017;364(23). doi:10.1093/femsle/fnx051
33. Wang Y, Yan W, Xu J, Ye C. Rapid, sensitive and reliable detection of Klebsiella pneumoniae by label-free multiple cross displacement amplification coupled with nanoparticles-based biosensor. J Microbiol Methods. 2018;149:80–88. doi:10.1016/j.mimet.2018.05.003
34. Wang Y, Wang Y, Ma AJ, et al. Rapid and sensitive isothermal detection of nucleic-acid sequence by multiple cross displacement amplification. Sci Rep. 2015;5:11902. doi:10.1038/srep11902
35. Wang Y, Li H, Wang Y, Xu H, Xu J, Ye C. Antarctic thermolabile uracil-DNA-glycosylase-supplemented multiple cross displacement amplification using a label-based nanoparticle lateral flow biosensor for the simultaneous detection of nucleic acid sequences and elimination of carryover contamination. Nano Res. 2018;11(5):2632–2647. doi:10.1007/s12274-017-1893-z
36. Wang Y, Wang Y, Wang H, Xu J, Ye C. A label-free technique for accurate detection of nucleic acid-based self-avoiding molecular recognition systems supplemented multiple cross-displacement amplification and nanoparticles based biosensor. Artif Cells Nanomed Biotechnol. 2018;46(8):1671–1684.
37. Wang Y, Lan R, Xu H, et al. Multiple endonuclease restriction real-time loop-mediated isothermal amplification: a novel analytically rapid, sensitive, multiplex loop-mediated isothermal amplification detection technique. J Mol Diagn. 2015;17(4):392–401. doi:10.1016/j.jmoldx.2015.03.002
© 2019 The Author(s). This work is published and licensed by Dove Medical Press Limited. The
full terms of this license are available at https://www.dovepress.com/terms
and incorporate the Creative Commons Attribution
- Non Commercial (unported, 3.0) License.
By accessing the work you hereby accept the Terms. Non-commercial uses of the work are permitted
without any further permission from Dove Medical Press Limited, provided the work is properly
attributed. For permission for commercial use of this work, please see paragraphs 4.2 and 5 of our Terms.
