SUN1 silencing inhibits cell growth through G0/G1 phase arrest in lung adenocarcinoma [Retraction]

Huang W, Huang H, Wang L, Hu J, Song W. SUN1 silencing inhibits cell growth through G0/G1 phase arrest in lung adenocarcinoma. OncoTargets and Therapy. 2017;10:2825–2833.


This article has been retracted at the request of the Editor-in-Chief of OncoTargets and Therapy. It was brought to the attention of the Editorial team by the authors that in Lentivirus package and transfection part of the Materials and Methods section, the authors noted “a nontargeting shRNA (5′-GCGGAGGGTTTGAAAGAATATCTCGAGATATTCTTTCAAACCCTCCGCTTTTTT-3′) was used as control”. Recently the authors were advised by the supplier of the lentivirus there was an error in the illustration concerning the control group sequence. The correct sequence should be TTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAATTTTT rather than GCGGAGGGTTTGAAAGAATATCTCGAGATATTCTTTCAAACCCTCCGCTTTTTT. The authors cannot confirm that the sequence carried by the control group lentivirus was TTCTCCGAACGTGTCACGTCTCGA GACGTGACACGTTCGGAGAATTTTT so they have decided to respectfully retract this original research paper and perform the experiments again to retest the data.
 
This retraction relates to